Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs95 ]


Position: chr16:17,096,348-17,097,253 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: NPIPA8 - XYLT1

Timepoints:
e11.5

Publications:

This sequence did not show observable enhancer activities at E11.5
We define a negative enhancer at this developmental stage when at least 3 transgenics were obtained and yet no reproducible pattern of expression was observed. This does not mean that this sequence is not an enhancer at another time point or a weak enhancer at this time point but below the detectable range at our level of resolution.


Fasta sequence
attaTCGAAAAATATCCTTTAGAGACTGAAggatgtgaagaattgcattgctgattttag
tttctagaataagaatgtcatccagtgtaagagaaaaagggtgatcaattcaatgtggtt
catagatatcattctctaagatggcatgaattgatagttcaccgtctttggggtaaaccc
aacttttgtgaatttctaaaatccaagagacaaccacctcagctgcaaaggatctcatcc
agcttaggaggtcagtagcagctgataggacaggttccattttcacttcctcttagacat
cttgcctgtctctgccaaccttctgctatctgtcccagacttttacttaaagataaaaag
agaatgcttataattcattacagttcattaaaatgaaaataaaatttattttgcatcaaa
atgaaaaaaagactcatttattattagcatataaatggcatttttaaatgtcactctgcc
tcaaaatcacttacattttcagtgatcatagcacacaaaattaatttttgatagcctttt
gtgatttggctggaaattcttatttctttttgtgctttaaacagcaaactgtatccactg
ctattcatagcaaattttagataatgaagcaattaaaaatacatggatttaagatcttat
ctcatttttcctttggcctatttctgcttcattattcatgaagggatatgtttaattcag
agttagtaattgcagatatatctagtataaattgtgcctcatattctttacccatttcaa
tttattttagcaaatagatctctgtttgaaaaaaaagtcattgagagagggtgagtatga
caaaaatgcagaaatctgcgtgtatgtgtatattgattgacataTCCAAACCAGATCTCA
AAAATG
Primer
(+)CACCTCGAAAAATATCCTTTAGAGACTGAA
(+)CATTTTTGAGATCTGGTTTGGA