Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs878 ]


Position: chr1:88,615,687-88,616,927 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC100505768 - LOC101927891

Timepoints:
e11.5

Publications:

Expression Pattern
limb (9 out of 10 embryos) 
tail (6 out of 10 embryos) 

Embryo 1



Embryo 2



Embryo 3



Embryo 5



Embryo 6



Fasta sequence
CCATGAGTAGGGCATCACCTTActgggttttaaccatggtgctctcaccagtgttaatgg
acactagaaaagggaattgatggcaggcccgagcaaggcctgaagtattcattttgataa
ctggattcagtcacatttactccttaaaggttattagttattttaaataattttgttaaa
tgcttgagagggaaaatgaagacatattaataaacacacaattatacaggttagagcaac
aatgcagtgctggtcattcaggaaccctgtgctaattttaattagctgctttcccttgct
ttcaaatgtaattaaaggagcttagttgtgctcagtgatgcaagccaccttacttaatca
ctaacattatttccctgaactattaatgattttcaaaacgcttgtttatgcagaattaga
acagtaattaccttaccagttaattttgtaccttcacatttcacacctagctcaaacgtc
attcatttaccatggcttctctgtcaaaacaaagaaatgcttgttctaaatgtgcttctg
agtgccaaattgaaagccaagttttgtaacactaataaagtagctcccaagtgaaacagg
tgtagtaatttagacccttcctgtctcgagcttgcacgtacatgctatgtcttttcttta
ttagctttaaaatgagagcttggtgtgcaaaataagctatttaattcagacttgtggagc
agaatataatctttaatttaaactagtgcagtaaaaagaggcctttaattttaactggca
tgtgcgtgtgaatttgaattaataatccagaaaattgaaaccgttttgctgctgttgctg
gatattgactgttcttcacatgcccttagtttcactcactcgttttctctccgaaaccat
ggctagtgcttttcttcccatcttttttttcccttatgatgtagctgctttatgcaaagc
agagctttctgaaaaagaaagtctcagttgactgaacttcctttcccaaaaaacgccttt
aataaaagaatactaaatatgtattaatgtagtttacaaaaagaatataattggtgtgtt
cattatatctacttaagacataattcaagtgtactctgaatttatgcctgattgaatcct
ggatgggaagacaatctacccacattcccagtgacaaaacttcactgaatccaagtgtac
taattcctactctgaAGATTATTTCCAAATCGGGAGCaacG
Primer
(+)CCATGAGTAGGGCATCACCTTA
(+)caccGCTCCCGATTTGGAAATAATCT