Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs865 ]


Position: chr6:50,685,244-50,686,237 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: TFAP2D(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
hindbrain (rhombencephalon) (3 out of 6 embryos) 
midbrain (mesencephalon) (6 out of 6 embryos) 

Embryo 1


Embryo 2


Embryo 3

Embryo 4

Embryo 5

Fasta sequence
ataCGAATGTCCTTTTTCTCTTTTATTACtcatactgaagcaaaattactcatactaagg
gacacagtccaagatactagaagaaatatagtactgtgtgtgatatacgtttataccttt
acatagatatatccatgtatgtatatatcataatatatatccatctttatctatttaatc
tatgaatgctatgtagcaagtttgtaaatctgacaagttattttcttccactgttcttgc
tccaagttggcagaatgaaaaagaaagagtcatagctacttttaaaacaagaaatgggga
gggagtgtgtgggagaaacccgtctctctccttttatttcttcctttttaaaacattcat
cagcatatgcctcatttcaaatgcaacaaatgtaaatatacttttccctgcacagaattt
taagtgaaagtccaatggtttggagggcggtctaagtctgcctaacagatgcaaacagtc
ttgtggcttcagttccatctttgagtcccctaaaaagatttgctatggccaacaaaggaa
actgtcacaccttttcccatcaccgctttaatttatgctcagtctccaagtttttttttt
ttcatattgatttgataatcactttaaggcagaacatttaaaataagaaagagcttgtga
gtaggttgaaaaggggggtcttacaggcctgcctcaatatggtgaaaatggggaggcgaa
agggagccagggttgtaaaggttgttttgtaaagtgggtttttattatgcaccgactctc
tccgcatttacttaactcttcacgggctgttgggtaggttaacacccttcaaggcctctt
tcatgtccaatacctcgtttgtttgtaaaggaaaatgagcctttaacacattttgatttg
ggaaaaaagaaaacgacagacagggagaaatttttatttttcctaatcaaaaatcagcaa
actctttccatcTTTCCAGCTCTAGGGATTCCTC
Primer
(+)caccGAATGTCCTTTTTCTCTTTTATTAC
(+)GAGGAATCCCTAGAGCTGGAAA