Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs853 ]


Position: chr5:87,083,012-87,084,752 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: CCNH - TMEM161B

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (7 out of 7 embryos) 

Embryo 1

Embryo 2

Embryo 4

 
Sections available
Sections available
Embryo 5

Fasta sequence
AAAAGGACAAACCATGAGAATCCtgatagactatacttgaaataaaataggaagtccaca
caactgaaggtgaacaaataatgcaggctgaaatgagtatctcttcgaaagactacaagc
ttccttttgacattcaagcaattcagtaaggagggaaagcgaaattgaatttagccgatg
caaatgaaattaaaactaaattggttgtcacatcaaactgatgttaactatgtaaatgtt
ttctgtttatgaaactacagtttagagtatataattctgcaaaaataagaatatttttgt
gttcttttaaaatataaattaaaagggcagattatgaaattgtttaaaatccttgccact
tacccacgtaatatcaaaggacctatgaatcatgaaaactgtggacatagagtattgaaa
taaacatacacatatagatatgcacatcaatacacatgcatgcttttctggccaagcagt
accccattacatcattgcttcaaatgcattcattctcttcaatattgttggctgtttcag
gttaactaccaaaatcatttgcctgagaagcgagatttaattgtcttacaactacctctg
tgaggtacaatagggattacaagtacccattgattatactattgggtagaataagggact
cttattctagcatttctcattcattttgtcattgcattctctttgaaagagaccaaatgg
gtcccagcaggtgaaagcaaagaaacctgaaaggccccctttgatgaatgacaataccac
aaccaccctcccccccaccatttttggagattataaaaccttattaagtcatgccctgtt
agatattgattgagagggagctaaactaaaaccaacaatagcagcatggatcagagaaca
ctgctttcatcaatgggcactaaacacagctaagctttccaatcttttctgggggggcag
ggtggggggacttttttttttactatttacttttgtttaaaccattatcctagaaagtca
tacaattatagctactttgtcagttaagaataaatcgtagttgtctagcacttcatcttt
ttgaatgtagcagtgtattgcacaaacaatattatacttggttaagattcaggattatta
ttatgattattggggggtgcaattctgggtaattatcataattattcttgactctgggac
tcctttgatgacaacgttgctttaaagtaaaccacttggacataaaacccaagatatttg
aaaagagactgctgccagaatcagagttgaaaactcacccatattttaaagctatcttga
ttatcaggctgtttgcgttcctgggctgtcttttctgccatctgtgagcgccacagcaaa
caacccctttatgacaatcacctcagtataacttgaatatgtctgctttagaggagactt
ctgtaataagactctgtgctaattaactgtcagcctttttaaaaaaataaataaataaat
cagcagactgcattttagaaagacactccaccaaaaaattcccaaacaagatttaagttt
atgtgccagactgtaacttctactccatgttttttcaggccttcctctgagtaaatctgt
ttactttaaatacttctcatgtgataaaggttttcatttttcttgccagttgactacagg
tagtaacatttgctcctccttctaaacagctacTTGATTCAGTAACGTTATCCTCCAaaa
a
Primer
(+)AAAAGGACAAACCATGAGAATCC
(+)caccTGGAGGATAACGTTACTGAATCAA