Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs840 ]


Position: chr4:66,989,480-66,990,366 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC100144602 - LOC101927237

Expression Pattern
forebrain (10 out of 10 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Embryo 6

 
Sections available
Sections available
Embryo 7

Embryo 8

Fasta sequence
gtagACTTTTCCCGGTGTTTTCATCTacataaggtggcatgcttgttttctgattactcc
catgatcccaatgccttgtccatccctggggacaaatcaaagaagaaaaatagaaggtca
tctttgggtcactgctattcagtttgctgtgccaagctgaaaaccaaggccattaaatat
gaaaatccactcattgtctcaggcttgattgtatcctgtctttcagatcagactcaccat
agtcatagcaaccctaataggcggatgtgcattggaccacatcatttgcagggtgtcttt
aactgagaaaagttttgttgaaaatatgtgtgattaatgccttcaactattatctctcat
tgaacagacatgaaagggggctactttgtgagcccagataagcctattgcatggccatta
atggcatattcagcccttgctgaattaatctattattgcctcttgtctttggtaaccata
acatgttgttggaaggctgtgcaaaatttgagtaactgaaccacagctccagtaatcctt
tagacctgggtgtaagagaagagtgaaaagctgtttagtgactaattgagtgtgctgtgc
tgtttcattagtattaagcagtggttctttattttaatctgtttatatcagagtgatata
tcaccttaacatcatcagttactcagcaagcttcacacagttcctctatccataaatata
actaaaataaaagatcaatagaaaggcttaaatcttgtgtatgtgtgtgtgtttgcgtgt
gtgtgtttgtgtgtgtgtgtgtgacagagagagagagagagagagagagagagagagaac
cagagaaacagagagagacatagcaCTCAAAGCACAAACAACCAAAA
Primer
(+)CACCACTTTTCCCGGTGTTTTCATCT
(+)TTTTGGTTGTTTGTGCTTTGAG