Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs836 ]


Position: chr2:59,540,640-59,541,937 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC101927285 - MIR4432

Timepoints:
e11.5

Publications:

Expression Pattern
facial mesenchyme (5 out of 12 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 7

Fasta sequence
CATTTTAAGTCGGCAATTATAAGCAgagctgttaacagaacgctgcttgattattatgtt
atgaagaaaagaaaagaatggcaagggtaacttgaaaaaataaatgaagtgcagtgagtt
ttccgagaagcagagaatgaaactgagagattcttgttatttttaaaagctgctgagttg
gtctcacttctttgctaagtctctcaagtatttttttttcctcaaaaggcttgaataaat
acctgccctgcactgaaggggaaatgcagaggttcagcttaccgacaagtggacaggtgg
cgaaacaggtatgggcatttctgtttcaggtcagcttttcatgggacttaattgaataat
atcacctctcactttttccctttttccccctcattgatcaagctgcttttgagaaaagtg
atactttgcatatctggctaagtactgttaacagcctctgcctgcggtttgttaaaatta
aaaaaaaaaaaaaaaaaaaaaaaaagtgtgatcttgccggagaagtaatttgcttctctc
caaccaatgatggcttgtactttatgcaaattggtatctagggacaacaaatcccattta
atacatatgcatagttcataaaaaaacgacgtgagagaaaagaggaaaaaagataaagca
acgagtcagcaaaagaacaggttccgaggaaatttattgtcccaaattggacatttgtaa
cagatgatgtgaacaagtgttaactttgttttcagcagctcttcatgtacattcactaga
catcacacagattatgttttaaggatctgaactgtaataaaaaaaagtgtctatgggctt
tagagtgttgtgttccatatggttagggaagtacggagttattgcgacaagcatcttgtg
aagctcattacgcgcggtggtgttagatgcgaattgccgcgcatagctatagggtacgta
catgacatcccacagtcagcagatagcaactggaaatgaaagatatgaaggcacagagta
cagcttcagggaacatgttagacaaaacatctgctggtatcagaacactgcattatcaga
tcattgtggccatgaattttttatagacacttttttcccccaaaccgcaactttgaaagt
gacattttgtgcaaaaagtttttgattgaagtgtgatgtcaggaggaagtccagtgctgt
aagtcgttgtatagacagccgacactggcagctcaagaaaactcctttttgcaaagtggg
gcaacctcgacTAGGAGAATTTATGCTGCAGTGCatgc
Primer
(+)CATTTTAAGTCGGCAATTATAAGCA
(+)CACCGCACTGCAGCATAAATTCTCCTA