Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs830 ]


Position: chr15:38,159,507-38,161,007 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: MIR8063 - TMCO5A

Timepoints:
e11.5

Publications:

Expression Pattern
midbrain (mesencephalon) (5 out of 5 embryos) 

Embryo 1



Embryo 2



Fasta sequence
gtgCACTTGAAATGGCATGTAGCAGacccctgccaggtgggctgcctcccaaagttcaac
aggaacagtgtgagtgggctaagagatggatggcggcccttacctgaccacgatgggaaa
acctttaaaaggacaagcaagcagcctaatttcttttattcctcaaggcaatggtggggc
gttttgatctttcctgggtttgtttctcagccagctctagtcctttgtcttgcccctttc
aatgaggttctgcagttttattttatctaaaccagaaaacgtcgcgtgattctgtaaatg
ttttcttgctgttgtacttttcagactattttcttccttgttttttggaggcctgaatct
gcctttggtcacactatttgctcctctatggtcacctcggagaagattaaccctttcatt
aaaaaagcctggccagggtcaaactaccgcctggctagggactcttacatccctttgatc
tcccagctatggagaaattattagcaaattctaagccttcccatgtgatttgtttttgta
aatttgtagaaattattcctaatcctattacgtggcctagggcaaacctgcattaaatat
aggagactttttgttatgtggcagatggataataaaggaatgctgaatgcagctccattc
caagttatgggaatctggacacttcatcagcattcacttaatcctctgccatagctccgc
ctttgatgaatgctctcatttatgaccactgatgccgctcacttaatttcagagaagaaa
aataatacctagctgttaatgtgaatatttgagtttatggctgtacaatgaataattgtg
acattatcaaaggaacatctccttatacattattcagttgtatagaccacattaaccaga
gattggaaacttgcaattttgcatcttccatcttctttggaacggagacaccatgcagac
aaaagtcagtgtctcaaaccaaattctacctgacaatgcgtatcagcccgcactatattt
tgctcattgtggtgccaatctcctatcttaccaatgacattttttcaaagaaagagggga
tttcctagagactcgaccccatgcaacttccatagcttattattgaataggaaaatgtag
ttttggtttctgctttaaaactgatgccatggaggatgtcttgagggttagactgaaaat
taagacagcacacctttgctgcttatactttatatataaactgagggcctttttcaatgt
aagttttcacttagacagcaggagagaatggaagtcacccatgaattaccaagcctttgc
tgggttcagccaggcagagatccgtgctggtaccattaaggacagtcatgcaaaatcact
cacttctctgttacagaatagatatgcctcagctgcttcagcattgtatgcctttgtttc
tggggaagtaggggatgaggtgccagaaaaggcatgtAAAGAGTAGGATGGAACATTTTC
A
Primer
(+)CACCACTTGAAATGGCATGTAGCAG
(+)TGAAAATGTTCCATCCTACTCTTT