Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs809 ]


Position: chr1:87,795,192-87,796,737 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LMO4(intragenic)

Expression Pattern
branchial arch (5 out of 14 embryos) 
cranial nerve (4 out of 14 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Fasta sequence
gtagAGGGGGTGGGGATATTTCTAGTtcataagggaaaggcaaggggtgcttagatgagg
attttaagtatgagaagtagtgtgtttgggggggtgggggtggggatagtcacgataccc
cccctcccttctagtaaacactatttttgaaacagtggcaggaaggatctaagtgagcag
gattcggtattgctggttcttttaaaaaaattcttcttggcttataagtcttttgttcca
atccaggagaaatacggtgaatcacctaattaaaatcaagacatgaattaagcatccatt
tttgtactacaaattgccagcgttacgtttgtccctcccttggtctccattaaaaaacac
cagagacgttgttaaaggggggcagattttgcctctagctgccagttctgctttctattt
cactgactatcccaggacctaaattgcttggctatgtaattactagagtataagcctatt
taacttaaaagctttcttttttttttttttttttccaactctaaatgaaacttgatgagg
gcccgtccttagttatcaggggagtcagtttctggtcagtcttcttgattcatctctttt
agatttaatcagcattaaggtattgcttgtccttaagagctttagctaatggggttactg
gatgcttttctcagtgtaatgtttccttttcaaaaaaaaaatacatatatatttacctct
cactaaagatgggggcggggaagagcttggaatctcctccctcactctccttttaaaaag
gaattcggagcgattaaaacgttgggggaaacagtttaaagatctagggcaggaaatgca
gattcatttgggttagggctgaaattgtaacaaaaagcaattcctcgagtaaatgcatca
gataaatcaatttacataaaggtatgatgcattcggataaatgcaatgctaatgggtttt
agagtggtcctgtttccaaagtctcagggttttgttacagcttaattggtgcagttctta
ttctggtttattgtgcggtcactggacacacgttccgggactctttcggaggaaatgtgt
ttaaaatcggcctatttaaggaacccgagtccttgtttcgttccttcctcgttttttttg
cagcagccaagttgggccgggtacaggcaaagttcgccttcttctgaggtatcagctgaa
tgtcttgagcagatagccgggagcctcagggggagcccacactctcagcttacagaggac
aaagacaatacaggctgcttaattggcagtaaataacttgatctttttacagaataagtg
actagaggaacactaggactttattggactcgggattgaaggcaacaaattaatcggttt
aggctaagctttataaattgattcctatattatatcccagttgcatctcttgtggcattc
attagagtggggaattcttttttaaagcagtttttggtgacagcaggacgggctcgaatt
taacttgtgcatcccttaatggtgCCTTCTCGCACATTATCTGTAA
Primer
(+)caccAGGGGGTGGGGATATTTCTAGT
(+)TTACAGATAATGTGCGAGAAGG