Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs798 ]


Position: chr12:16,170,590-16,171,824 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: DERA(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (9 out of 9 embryos) 
neural tube (8 out of 9 embryos) 

Embryo 1



Embryo 2



 
Sections available
Sections available
Embryo 3



Embryo 4



Fasta sequence
atatTGAAGACTTTTAATTTGAGGGCTTATatctttgcataccctgcttaatttttttcc
aagtgtcccattgcagattgcaagtataagttagtgtcggaattaccatacgaaactctc
tttctaactttaatcggtaatttctcagcaatagaaaacatgatgctaatgaataatgta
cccaaaagctcttattatagggttggtatgaattccacttaatgacaagctttctcaagc
agcagttgatttgaaatcctacttttcattagtgaagtataaaatgttaataataccttc
cactgtgctgttcttttgtagcatagcagcatatatcttccctgttcaccatggactctt
tttaagatcttactagtaacttcctataacataaataagatttgttcaagaaataaaaat
gtgtgttttcccattgttagctatatgtttttctaataatcacatccgaagcttattata
cagtagtagccttaagatattatttttttaaatatactactttggtcttaatactagttt
ttaatctcttcttgtttctatgaagtctgaatgagattttcaaaattgaataataatttg
atccgttaatcttttgaagctagtaattttattttcctctctttgcagtctctgaggttc
gcaaatgaatagagcttcattattgcagtctgcatttaataacaattatccattatcttg
taattaagactccctgtaacgaatcatgaggacaatgcaaaaatacatagtacatttctt
taatgaactggaaaatgttcatcttgttctatttagtaatgagttgctgaatagtcatta
aatccactggagaatagagctagatggattttgaagactgtcttgagtttgtggttaatc
tattagaattaaaatttcatcttctatttttatcaacagctgattagaagtcattctgtt
tgaccaaattgattagaagaccatatacaagggcagctgttgtttaatgaaagtttttaa
tgaaactgtaccatggagacttgtaattatagtccttagaaaagctttgagttgccttag
accacaaaaatagtattgtgctaaagatttcaaattaggaaaataaaaaatacaatttaa
tataatactataaatttattattaattttaatttcaactaatcacagttgaatattagtc
tacttagtgtgttCCTTTTGACTTTTTCAGCCCTT
Primer
(+)caccTGAAGACTTTTAATTTGAGGGCTTAT
(+)AAGGGCTGAAAAAGTCAAAAGG