Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs79 ]


Position: chr16:51,056,311-51,057,592 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC101927334(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
hindbrain (rhombencephalon) (10 out of 13 embryos) 
midbrain (mesencephalon) (13 out of 13 embryos) 
neural tube (8 out of 13 embryos) 

Embryo 1

Embryo 4

Embryo 6

Embryo 7

Embryo 8

Embryo 9

Embryo 10

Embryo 11

Embryo 12

Fasta sequence
ttttGACCCACTCTCTGCTTCTTGGTAGAttctaagtacagatctaattattttttcctt
caagtattaagcgaatatctctgcaaacaaatccaaatttagaaagctagattgaagaaa
tggagaagcaaatctagtcaactcatagaaatctttcttctcctctcttgctctgtctcc
aagagaacctctacaccttcttttaaggtgccagccatcttaagctcttgtctgattaag
aaattctctggtagaaccagagcatctgcaaaagcataaaatatgatcacagcctttgca
caagtattttaacaacccaaccttatgataggttatatttcattgacttggaagaaacac
tgcattatctgggaaaacagcacagatgttgcctaataaacgttttggtttatgcattgt
attaacctcatgaaacatttatgcaaatctcacattaacaaaaggtaaaagaaccattct
atgttatgaagcatacaacaggatgatctttgtcatgtttttgtttctgttgttgttgtt
tcaccttggtattttatgggtctgtttgtaactcttggagtttctatttaggaggacaca
agagcattgcagattttcatctcttctgttttcagttctgttatcatcccttccagctga
cttcacattttatgatgctaatggggggtgtgtggttttgagtttctctcctgtcagctg
gtcagtgggtctgagggatatatttaatagaatctgacagctgatggaactggcctcatt
gaaagaggatttgatatgtggagtgaatgtggcgaccctgaaatcgccataataacggcc
attattattctgcctctcgcagccaatataactctccctcttgtacacaccagtacatgt
gtataaaagacatgacttatggatggtttcttccgtacactgatctgagggccatttaga
tagcatgtcaaaacagattaactgtcttatcctgccacaaaattaagggggggaaagaga
actttacacaactctgcccaacatatgcactctgtgcccataaacaaagccagcacagaa
gggccacagattgtctctgggtgggggttaagagaatcaggcacccagaaaagctgcagg
ctcacccacttaaggtgcccgctccagtgaggacccaagggcactgcctgagatatggtg
agggcagctggagccacaggtaggaacctacctcctgaaaggctggtgctatgctttacc
TGTGTGCATGTGCCTGGGATGT
Primer
(+)caccgacccactctctgcttcttggtaga
(+)acatcccaggcacatgcacaca