Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs774 ]


Position: chr8:77,690,683-77,691,779 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ZFHX4(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
limb (5 out of 5 embryos) 

Embryo 1

Embryo 2

Embryo 3

Embryo 4

Fasta sequence
acCCTGAAGAGGGCTGTCTCTGAgcctccctccacaccacttcatcacacacacacacac
acaaacacacacacacacgcctcaaactctccaactcgagcctgtcccccagtgtaaaac
acggcagctcttaatctctcagaaatgaacatgttgttcccattaaagctttctttttat
atcagtaccatacgcggtcctgcatgcggtgacatctttagcaggcatgcaggaggttat
gaaactctaccttgggaggatctcacagtgaaatttttccccccagagtgagctttaatt
tcctttctcatgaccaaagcaatttggctttcatttaaaagtttctttgctgccagcagc
taataagtgtaacaggactgtaaaacattctgagacaaaaaaagattaatagttttattt
gagagagaccagtaatttaaaacataagacctagtcagggtccattatacaataattcca
atgttaatgctactttgcaaaatgagcgcttaacttgtttttgctttggttgacctggtg
cagggaaacagctaacacgttttgaatggcattccaaaactgaattaatctctgttccct
aaagtgtcctgtttatatatgaaatccagaaacagatggtcgtgagctaaaaaccacatg
cgaaactttatgcattaaaactacccatattggaattaaatgagacggctgtacttttgg
ctttaattataaatggatcaaaggtggttcagggtttgggtgcataaaaaagcctattta
gataaatcattattatgtatttaaaaagtccgttttcccttttttttcttccttttggca
aacctaggtggtgttttaaatctgtcaggagacatatttactcagtacacctttataaat
ataccagtgttaaaaatatacttgaattagtggttgtgaacttcaaagtaaagtttagac
aggtcaggtgagaagcgtcaaggtcgcctttctcaactgagcattcttatctactgtagg
ccagttggaaaatcaaatcagcatcagtgaatcagaatagagcacagagcttgAGAGCGT
ACTCCATTACATAGCAA
Primer
(+)caccTGAAGAGGGCTGTCTCTGA
(+)TTGCTATGTAATGGAGTACGCTCT