Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs769 ]


Position: chr7:26,524,662-26,525,636 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC441204(intragenic)

Expression Pattern
neural tube (5 out of 7 embryos) 

Embryo 1

Embryo 2

Embryo 3

Fasta sequence
gtatATTTACCACTGCATCGTTCTGGgatttctctttttttgttgttgttgtttttaaca
aagttcatctgtgtactaaaaataatcgcaacaaaataaatgcaacacaccacacccccg
ctcttctttatccttttgataccattttctctgtgatgtaactgagtgattttgcagcag
aaagctccaaaaattaaacctgaactttccaaatagcttcctaataaccgctgcccaaat
caatggggctccatgaatattttgacacagtttaaatgggtttgtatcctcaccactgag
atctggtgatttagcctgtcaggctgcaaatgtggaaatatcacctctcactgagcaaag
tccaatatctcattagaaatgaaaatagaagagaagggaagcacaaatgctgtcagtggc
ggtgaggaaagaaattaaacctccggaggcctgtatatcttatacaaaagattatgcact
gccaggctatataaatcatgccagggctctggggctgcaatgggctagaaaataaaaaac
cataaaagtgtcatattgaaatacagtcactgagaattcttttatgatgagtctaaattc
gcctgacattctcgcaaattcaggggcctgcttgggttgtttatccccggcctttctctg
tcagtcacgaagtcccagtttccacagcaaattattctaaacagggcttattatcaaggc
ataaaaaagttaaaacacagatggctggagagttcctgtttaatttaaatgccctgtggc
ccacatcaatgtgagtctgtcttgccctagatttactatcaataaattggctgcacttat
tagatggcagagccctaagatgttggtgggagtatttcaaatggaattaacatgaagaga
tgcagagctgtatactatcatctgtgaaatatggagaaggacaagcaatacatAAACAGG
TATGACCACTTGCAC
Primer
(+)caccATTTACCACTGCATCGTTCTGG
(+)GTGCAAGTGGTCATACCTGTTT