Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs76 ]


Position: chr16:51,231,121-51,232,362 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SALL1 - LOC101927364

Timepoints:
e11.5

Publications:

Expression Pattern
midbrain (mesencephalon) (3 out of 6 embryos) 
neural tube (3 out of 6 embryos) 

Embryo 1




Embryo 2




Embryo 3



Fasta sequence
AGCAATTTCATGTGGGTCAACCTGataaaatgtggtatggtgattcatatctatagagac
ttatatccaattataaatataaattgctattttatttccccatcgcttctagttccacag
tgaaagcaaacttcagaaaaatgacacaactggaactatagctttttttttctctctttg
tttcattttatgctctccccaacattccacccccaagttcccataataatatctcacaga
gatttgtaggggcaagctctgttaatcagaaatatcccaaagaagagggtagatttgtta
tttctgtgttaaattgttaattgatttgataattgcctgggagacacatacagacataca
catacacaaaacaaatgtcaggccacacacttttctctcgacagtaagatgaagatgttt
tagttattggaactcgatgtcacctagaataagaggaggtaccgggaaaaaaagagggga
gtggagccggcgtggtggggggaggcaggcgatccctcttggttatcaaatgaaatgact
ccccaaatatgacaataaatcactgcaggaatcaatcagacaggaggccactgctccatg
ctgataatgcatcaatcaatatttaatgtttacactttaattaatccacacatgggaagc
attctttcagtgacaaaaataaaaggatgagaaataaaacaccttttatatcaaggagtg
gtgagtgcactgtctactgggtggctttgattggagctgtcattgatcaccttgagctca
ccagcctccgagtcacatttggatataaagctaatgtagggggtgggggcagaggtttca
gcatcccgccttcgaagagtgcagcttgctgggaactgctgtggagcatggattcctgtg
aaggaagaacaaagccagggcaaatattggattctgaacgccagtgacatcttctcccca
gaaaagatttctgtccacagatggtgatctataactctgagggaggcagtttcagccaga
aagacattttctcatgtgttttcaagagtccagtgtgtagtcttggacacagggattcca
gtctgaaccacaggactgttttataacactcatagcccatcagcctgcctttttcatgct
ctgcccggcctgctatcaatgatagcatcctaaaatacccacccctcgcattaattataa
ttcatatatagctgCTCACGAATCATTTCATCTGTGGTTGAC
Primer
(+)agcaatttcatgtgggtcaacctg
(+)gtcaaccacagatgaaatgattcgtgag