Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs755 ]


Position: chrX:136,316,806-136,317,871 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: GPR101 - ZIC3

Expression Pattern
hindbrain (rhombencephalon) (8 out of 9 embryos) 
midbrain (mesencephalon) (8 out of 9 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Fasta sequence
acCaTTTTAAAATCACACAAGAAGATCTGGctgcatctatctttttccagagcatcaaag
aagctcctgtagtttttaatatttgcattttaatttttgtgatttttaaaaggcattcag
aagtgagacttgaacttaggatgaaaatgtgagggcttcatccttacaaaacagcccctt
tctgatgtggttatccaacatgggcttgctacaggttgtcatggtgatagtgtaggcctg
aaaattttcacaggctcaaactatgaagtttttgaaaactgttttgattaatttttcctc
cactccaacttctctctcacttcgactgttttctcttttgtttcacacttgatttatggc
aggttgctgtcatttaaatagatgtgcattttgaaattcctcctttctttgccaatgcaa
agaaaaaaataacccatgcaagtcatgctcaaagagttggttattgttgcttgctggatt
tcgactctctgtggttgtcgggcctaattcaaagtaattcaggctccacagtgggggcag
tgcatagctccacaggaaattatgatagcaaaagtcttcctgtcgagctctgcacttggc
actacaaagtgcctcaggctgcagctacctgaatagggttgaattagaccagacaaccgc
atcatcccacttcttaatctattagagcgatatacaagtggcaattgttgattgcaaaaa
tgggattaagaggctcttcaagtgaattgattttcttgtgagaacaaaaagaggaaagag
aagccttcgtttgaatcacacagccagaaattttcatgaatgggttccactccaaatgtt
agaattaaagcaatcagtgagtccccatggggtgtgcaggtgagagaaataaactgctct
aaaatagcaaattatgtgcaaaacccaagtttaaggcatctatctgcattgaaagactgc
ccagaataaagtagccactggaaagctgcctaataatgtgacacagacaatgatttgcag
tggttcctttgtagatttgcacacTAGTGTTGGCTTCAGCTGGAGT
Primer
(+)caccTTTTAAAATCACACAAGAAGATCTGG
(+)ACTCCAGCTGAAGCCAACACTA