Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs742 ]


Position: chr8:78,042,571-78,044,201 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: PEX2 - PKIA

Timepoints:
e11.5

Publications:

Expression Pattern
eye (6 out of 8 embryos) 
forebrain (7 out of 8 embryos) 
hindbrain (rhombencephalon) (7 out of 8 embryos) 

Embryo 1



 
Sections available
Sections available
Embryo 2



Embryo 3



Embryo 4



Embryo 5



Fasta sequence
aAatGGGCAATATTTTGTGGCTTTTTaaattacctgatttgggaatgttaaaatattctt
ttctgttgaaaaacatatgtgaaaatatgcctctcaacttatgtgaacttagtgaaaacg
ttcagtgattttgtttgttgccaatgctgtttttctacttgtattgaattatagccatat
tgtgtttatttatgttatgatgattagtatcattattttaaatttgtgtctctctgcttg
cagacttcctcttgattggtacagtatgacaacaggtaatagatacaatagcactaaaac
agtcatcatcgctgctgggatgagaaacccctcctctttgctttttttaaccttcctcag
ctggaaagttttgacatctgctggtttgggacatggctgagcagctgtcagcagtagggt
agctgctttcagcagcagttggcgggatggcagggtgccagcttgtaccatctgtgcgcc
tgacatttcattctaattaacagtagggttaattgttctggcaggctcaaatgtagtgtc
taacattacccaagggaaacatgtacaagtgcaggagtggcagggagctggggacaagca
tcgctaacaaaaccatcgagggagagtggttaacaactagcggtgattttactagctggc
cacttgcaataaggctaaggtattttttattctgatgaattatgccaagcctgtaatgat
atagaaggaatcaagcttagaaaggctgagactgctgccttagggcaattgtgagggaac
aatttgcatgttattactgcatattcatacctaattgtgttaggctttgctaatagagca
gaatgacagtatgaaaaatcgagcaactgctttagaggcaacaaagccaatatttttttc
ttcctacactatgagtgctgaatgatcatttagacatttagttgctcaatatgacaagtc
caccatttgttagcttgacatattataatttataaaggagtattctaattttacttttag
tttattcttctcattttatacaatattcatgatagcaatttgaatggggatattcatagc
tattgtgagtagctgtgatttaaataaaactatatttggtatgaaatattaccattgttt
tatgatgtattaattttaatgtttaaatagctttttcatatgttaatataacataaacca
agagttgatgagaaatccttattatagtggtgctcactcacattgctatagttaatgtct
caacatttccattatatgaagacctatttttagtgtggcttggacaaagaaattgtcatg
gggtgcaaagccaaaatctgctgttttagaaaagtgactacagattcattgaactgagta
tccgattccatctcctaagcagataatattcttaagaaattttaagcccagtagtacatt
ttttatgttagcccacaatgccttttaaaatctttttatggaagctcagagaagacaagg
aattagaaaatttaactttagaagactacattttaaaactggtaacatatatcttccatc
taattttctttcttttctgatttataaggccatagttatatctttgattTGTTCCAATTT
GGCATTTGAAT
Primer
(+)caccGGGCAATATTTTGTGGCTTTTT
(+)ATTCAAATGCCAAATTGGAACA