Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs74 ]


Position: chr16:51,560,196-51,560,925 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SALL1 - LOC101927364

Timepoints:
e11.5

Publications:

Expression Pattern
midbrain (mesencephalon) (6 out of 12 embryos) 
neural tube (4 out of 12 embryos) 

Embryo 2

Embryo 3

Embryo 4

Embryo 5

Embryo 6

Embryo 7

Embryo 8

Fasta sequence
TCCCTAATTTGTGTGGCTCCctaagaaacattatctcaactccgactcttccttttttat
ctcattaaaataaaacaaacaaacaaaaaaacaagaactatagacctccatgagagacct
cacttaaaagcaaaatattctgttagtttgaaataaaccagagaatcaaagcctccctat
cctctccaatctccacccgcgttcagatacccctgccacacacacactgaaactcagctc
cagctctctgtccgcattgccccctttctgccccctccacacagacttatttcataaaaa
tgtcagctattaagttagcattatttaaggggctttgggttttagttcctgaatgcaact
taagctggatccgtaaaggcctgacacgaagtcccggctgtataaaacatgatccacgga
ggtactaaataaataacctggctgtgggcttccaggccgctctatttatcactgcagtga
ggataaggatctgatttagagtgaaccctactgagggtcgaacccggcacaagctgtaat
atgatctgcaggggagggctgataacccgaaacaatgtgaagaaaccctgtcagataaat
aaaacaaactgtttgtccattaaatagcgctgtcaggaagagaacagggaagccaaacag
agctaaatccaattcttttatagccacacaaagccaggaacacctgaactAAGCTGGGGG
AAATAAGCTC
Primer
(+)TCCCTAATTTGTGTGGCTCC
(+)GAGCTTATTTCCCCCAGCTT