Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs73 ]


Position: chr16:51,576,725-51,578,101 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SALL1 - LOC101927364

Timepoints:
e11.5

Publications:

Expression Pattern
neural tube (7 out of 9 embryos) 

Embryo 2

Embryo 3

Embryo 6

Embryo 7

Fasta sequence
CAGTTTAGCTCCTAGGCATTGCGcaggatcacctgccgcatgggttgccactcgcctcac
cctattttaagattttttaaaacttaattacgacaagatggaatatccctctgtcaacaa
gtcttggtaactgctggctcactctttttcttcttacccagggcccatcctttttcttct
caaatcctatttaatttttgcatttcctgatttttatcttgggaaaacaaaaaccagctg
cagtcagttaaggaaacagctgagggatgctggcaggtagaggccttgcagattttcagc
ctgaaattgtgaaaactgaaatgcagcgtgtcaggttgcagtgacttctgcacctcccca
gttctctcccttctgcctgcaaacacacacacgcgcgcacacacacatacacacacacat
gcatacgcatacactcatgcacacacaagtccctttttctcgcctcttgcctggcgtccc
cctcactttctacagctgtatttctaatcagcagaagatacatcttgcttggagtcaaca
ctccttttctctgcgcattcttaaccttctatcttatgcatggatcactggttagcttag
aaatgcgcagacacaaagggggagctgacatgtgaggtttgacggccataatggctgttt
ataagcctaatccatcacgtttagtggacacctccatttttgtccctctgaaaaggtata
aataataaaatgggatagctccagctcagaggtgccttggtaaatattttaactatttac
aaaatagcaccaataacaaaagaagcatctgtacccatgcacagaggggcccccggtcat
taagagagacccagatggttcctaccattcaaacaacaataacatttcttgatgacagag
cttttgtaacatggtttacattttttttccatatcacattgtgatattctgaatttgcac
tgctttttcttcattgcccccagcaacccttctaaagaaaatctccccaaatagcctttg
cccctaagaaaagaacaaggccttggaggaacatggcaaatgtgtgattcaaagcccaat
tcagagacaattctgaacagttataaaccaggccttcttaaagtccaaatattgacatgg
gcccacttattctgtggcccagttcaaggttagctttcggtaaacaccccccttaagtcc
cgaatgagctgtgccatctcagactgagtgcatgaatctgccgcactgggtttgatttta
ctctttcatgccaggcataaagagagtaaaatggaggtctgggaaccccaaaggagactt
ttggagttaaatgtcttttttctttgaggaccctgtgCGTGACTATATGGTTGGGGG
Primer
(+)CAGTTTAGCTCCTAGGCATTGCG
(+)CCCCCAACCATATAGTCACG