Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs72 ]


Position: chr16:51,657,810-51,658,716 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SALL1 - LOC101927364

Expression Pattern
limb (6 out of 6 embryos) 

Embryo 1

Embryo 2

Embryo 4

Fasta sequence
tTGCTGTAATTCTGAAAGAGGCAggagttgacaaaaaagagatcgagctgtttttttctg
aaggcaatttattggactaccacagggatgtttattttcttaactagaggtcatgagaca
caaaggccactaatgagtgaaattggtggctgggggagtccagggctttcctcacttctt
ccaagttcttcttagactgaaaaaaaaaaaaaaggaaaacaaacaaaaaacaaaaaaatg
gttccctgtaaattttatgactgcagtgtcaaaagtcttctatctaaattgcagtaaata
ttctaatgaagtctggaaagaaagccatttgtaatggctcggggcagagtattaagatag
cctgtttctagttagctggtcattagagagatctaacatgcatgggaaatggtttcctgt
tctaagtgctttaaaaccaagttttaggaaaccccgtttcctgccggctcatttggagac
aacagtgtgccaaccggtcagacttttcagatggccaagtggtcaccttctcagctacaa
tttagtttcgctgcagcagcctctaccagggagagtgggctttgcatctcaggggtcctg
gcagggagtagatagctccacagagcgaggacatctggacggggcaccactgaaagctgt
cctttgcctctgttgtaaatgcattgggattgagtgattcatgggatgagtcaaaaccta
caggagaatcttccagtcatcagcctagatacatctatctagaaacagactgaggggact
ggtgagaaaatggtggataaactccctggtttgggagggacagggtagctgatgggagag
gaaattcttttggctacctgatgtgctgtgcattaaaatgggattttCCAAAACAAGGAA
GTCCCAG
Primer
(+)ctgctgtaattctgaaagaggca
(+)ctgggacttccttgttttgg