Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs71 ]


Position: chr16:51,671,181-51,672,039 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SALL1 - LOC101927364

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (4 out of 6 embryos) 

Embryo 1


Embryo 2



Embryo 4


 
Sections available
Sections available
Embryo 5


Fasta sequence
ATTGAGGACAGAGACACTGGGAAAACactcctggagaaactgcagagtaggggcacatct
cataaaaatctaccttgtgtccaggatgagactgtatttcctccacgcgcctcaacctaa
tttcctgtggatttcagatcatcttttatttccaattatgctgctgttcacattatcgat
ttggaggatacaaatgttgaatgacaagagagggagaagaaggaggggggaggagaattc
cattttgcctgaaggataagatactcgaaatgccacccgcacagcctctctgaagcgttc
atcaacgtggcagaggctggctcaattatctttgtgtcagatgattatctgagagcttaa
tttaatctccattatcctcccccgtcatatttcaattaaatctgctatcagagtgttaac
acatctttgaacctgctatttcttcagttaattttccactaagaggtgctggagagtaac
agatgtcataattatgcaattattaagtgtatttgacactcgttctctcaggattttgtg
gttagggtaggagggttggaaaattaatctgatgacaatatgcttccgttgtgatccgta
acaccactgcaggctgggggactgtcctcccgctgtttccgaggctgccgccaaggaaga
taaaggattaactgattgtgcgtcagattcgtttcacttttgtatgtctggtaaattgga
tgagttcattaggctgagcagaacaccagaggcatttttttaaaaaataaaaaaaaacct
tcttcaagacctcaagaagtacaacaagtacatctcagggaatatggtaaaGTTATCAAC
TATAGAGTTAAGGGCAGTT
Primer
(+)attgaggacagagacactgggaaaac
(+)aactgcccttaactctatagttgataac