Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs702 ]


Position: chr2:105,132,815-105,133,830 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LINC01103 - LINC01114

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (8 out of 13 embryos) 

Embryo 1


 
Sections available
Sections available
Embryo 2


Embryo 3


Fasta sequence
CAGCCTAGAGCACAACAAccccagggacagatgtgacaggaaagtggaaggtcattaacg
gtttcatccccattattataggcccaaagcccacccttatgatgcactctgctctaagag
ggctagaaaaccagtatctttcatagtaatgacttccagtttacagccttcatttgttat
atttcctcaatagctgttgtgttgagattaactgcataaatggtctgcagctgtctgtta
tgaattaagggagtttaatcaaagtatttctaatgtacagcataatgataatacatgggg
gaagtactatttaagagataatgatggcttcagaagatcactgttgtaatgtttagtgca
tatgccttcagcattgaatttgttgttgttctgaatatgcttaatggatcactgaaaagc
tgcctaatgcgggattgtttgatggggctgacagagctggaattagcccattgctgttta
ctgcatacagccattaagattaattgctgccagataattttgactgtttttatcttctgg
aaaaagtgtcactaatgggtttataaattggttcactattactaatagtaaggccagtgt
aacacaatagaatgtcagctaattctaaagataaaggtaaaaaagtataaagtactatat
ggcttgctagttttaagggatactgttatctaataacagacagactgatatatgatgctc
attaatgctatttcctgagctttgggttgaacctaatagatgctaataaagtcttatttg
atgtcccattaaaaagctcaatctgttttctgcattaatgcccagtgttgtttatcacat
ctttgatgactaaaacccaagttccaatctgtttcataaccaagctttttctgagtgtct
ttatccctattttggtttttctacacatgaaatgtgtacaaccaaatcagaagaattaat
aacgcacataaatttataatcatgatataTGGTGTATGTTACCTGTGAAGTTTACA
Primer
(+)CAGCCTAGAGCACAACAA
(+)TGTAAACTTCACAGGTAACATACACCA