Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs699 ]


Position: chr10:130,831,457-130,833,175 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: MKI67 - MGMT

Expression Pattern
forebrain (6 out of 11 embryos) 
midbrain (mesencephalon) (6 out of 11 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Embryo 6


Fasta sequence
ACTCCAGCTGCCGTTTCTTTATttaagaagaactacagaaaagacctttaggaatcacct
cttaagtcattatggcataaggcacctttctgtctttatgacatggtggggggggggggt
acgatatttaattgaagattttatttttaattttcgcattcttaccatgtggtcattact
ttatttttacattttcagcccattttctttccagcccatcgcaggaattgggcagtcagc
aagagccagagagtgctggcatgtatcattacattctcaagatggcatatttactgcgct
tgccagcagggtcgcgcttctgtcctagtaaatgtagtggagtatgaaaaaggcaattac
atctcactgggtgaccttttaacagccatgactacctcctatctatacataattattata
ggtgatgatttccaagtattacaatctcctagagccgcctttaattcacatcacatttag
gcacgtttgtcaccagtgctagaaattttaacccccgaaaactgaaaaaacagaagagaa
aagtgatagcaatggatgtcaagctctcaagtcatcctaataaaaacacagcaaataaga
tgtcgccctgtttgtattcattatcagttcttacatgctccgactcttgcattaaacatt
agacagcctctgatgcctgcttaacagtttaattccctcctcagtattcaggctgtcata
ataaaatcagtgaagcaggcaaagtcaaataagagcaagaggaggcatagagcatgtagc
acaagccattgtcatcgcttactattcaccccgcaccacttacaggagctgaattcagca
tatgctgtgggtgacacacaaaccaatctctccctccaccgctgtggccagcctatcttg
ccggtgcagggcgagggtggcgcgcgtgcagagggccgatagcagtcccttcaaaaggaa
ccggcttctgagccactggagctggcacaatagaagccacttctgtcaacaaagactgca
gactaaagagctagatatccccactatggaaagattaacagcgctaaatccgtttaggcc
cttttttttacttatttacaggctgctgatcttgaaggctgaatcagaacaagagattag
ctctattaagtgctgcccatttttctgaattatgtttttgaagacttggacaatatgaat
aaggactcatattaaccactgtacgaaaggcgcacactccattgcaatgacaaagccttc
ggaaaactacttgtcacttgcagtgatccattgcaaatacagtttaatatataatttata
tctaccagctggtgagagcagaaagggagcgattccactctatttctcttttaaaagaga
gagagaaagaaagagagagagagagagagagaaaggctggcaatgtaggatgtcactaac
gatagtaaaatagctcagcaaacagttcaataaatggttcaatacttgtgatactatcca
aacaaagactcgaagccattaattttaaaaagttctgtgaatcttctttgaacagtaaat
atttaatcacggcaatatgtaagctgccctctcatattttatctcctaaccagaaccgtg
tagtgaacctggcctttaataactttgaccagagcgatattttgccatttttctcctgcc
atcaaattatgaagtgtGTCCAATCCAGCATGTTGCTAT
Primer
(+)ACTCCAGCTGCCGTTTCTTTAT
(+)ATAGCAACATGCTGGATTGGAC