Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs692 ]


Position: chr11:15,587,041-15,588,314 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: INSC - SOX6

Expression Pattern
forebrain (9 out of 9 embryos) 

Embryo 1


Embryo 2


 
Sections available
Sections available
Embryo 3


Embryo 4


Fasta sequence
CACATCTCAGTGGCTCATAagattctactgaccagagctctgcagagcccagggtgcagg
ctgggaaggagaaagcaaaggggacctcacaagtcagagtcattggtttcatttcccaat
atccaaatgcctctgtccaataagacctataaccaatttcccagagaaggcccccgaaga
ggctgagcttgatggagttgggtagtgggcttttttttttttttttttttttggcttttt
tttggactaaaagcaatttccattttatgccttttgtctcttcatccaagcaaatgccgg
tgggatctggcaacctgagttcaatagccagtccttttggtctttcaaaggctatgaatg
taataagagcactcaacccttctgaagatatgcaaatccgtgcatttaaaagatttacat
tcatccttcacaggccctgaaatataaatatgaaatacccagaaccttgtcacttcagta
ataattaagctgatggcctattatgttcgattgcaaatcaatatagtatcttttggtgcc
acttgagttcttgagggttggcgcggggccagctccagttatacaattgaattgctgcag
ctgcctgggaaacttcgctgccgttcccattcaggaagaataggcgggtaacaatggtga
ccagcctccctacagtaattgtgtacgaggacacatttccaatggggtttttgttcagca
ggtgctgttattttagtttaatttgaattctgaaatatggaggagagaaggagaccaatc
ttaacagcatctaacctacagctgttcgaaagaggccagcaaacagcatatgttgcttag
atggaaatcataattgctcattctccctgggatgttggcccaccaacgtggagcctctga
aattagctggcatttttctggcattttcctcagtggtgaggcctctgcagagctcaggag
gaactattctagagtggctcgctccctgggaggctttggtggtggcggctgctgcgtctc
ctttttcttctccttccctctttctccttcatggtaggctgaggtgaattccaaacacta
cacaaaacacatccagggttggcctcctcattggaggctgccatggggcgcacaaggaaa
caggcagtggcgaggtctggtggagccccagggccagactctctctgagagcagcgacca
acacccctgggtcagggtcagggcaagaggaaaactcagatagtaaggagaaTAGCATCA
ACACAGACACCCTG
Primer
(+)CACATCTCAGTGGCTCATA
(+)CAGGGTGTCTGTGTTGATGCTA