Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs680 ]


Position: chr4:85,245,591-85,246,555 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: AGPAT9 - NKX6-1

Expression Pattern
cranial nerve (6 out of 7 embryos) 
hindbrain (rhombencephalon) (6 out of 7 embryos) 
midbrain (mesencephalon) (5 out of 7 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Fasta sequence
AGGCCCCTTTAATCCTCTTCTCatttctaatgctgaaggccctttgagaaagggggaggg
gaggaaaacaaaaggttaattttctccagcctgcccaggccaacttaatgtaacagaagg
cagcaaattgtattgatttagtgacatgcaactgtccagaaagagctatttatacattat
tcaggacaaacactgtcataatggacaaacagcagcagcatctgggatgttaatgtctac
aaataagattattctttgaaaggattaggatgaagcattttgtgtaattagatttctccg
tttcaggaatgaattgccttttagcagtaaaagctgtcactgagggagccattagctcct
tataactgaattaaatgcataattagtgacatgatcacattaggatttgtttcattttta
actaatcggggtggggggaggggccgagggagagttggggagcagaggcggtgccatttc
caggtcactgcggccttcctcagctgggataggcctcagctggcgtgctgaagttggtaa
aagtcaggcgtgtgtgaatcagagcccgggcctcgccacggcgacggccaggctattcat
cactgggtggtgggtgacagtgactgatgggctaggcccgggcctggcacttcaccagtg
caagaatcatacgagccagggagcagaaagacagctggagcgctgtgtcaagtggtggag
agaccagagctattaataatgtgtgccacatgatctcagcctcaagaaaacaatgattta
gacattggtgagaataaagattttacatttagtccgggggtgactcttctccttggcact
tgtagaataaatcgctatgcaatcagcatgtatgaaaatcaagcagtgcatatattagag
cctagctcatgaggaaggggagcatgggtggggatttttaaatCCTTGCATTGACTACAT
GTGCT
Primer
(+)AGGCCCCTTTAATCCTCTTCTC
(+)AGCACATGTAGTCAATGCAAGG