Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs671 ]


Position: chr1:97,610,491-97,611,741 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: DPYD-AS1(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (7 out of 7 embryos) 

Embryo 1

Embryo 2

Embryo 3

Embryo 4

 
Sections available
Sections available
Fasta sequence
GCTGAGATTGTGTGATGTGGAGaaaaggaagatatgcagagatgttagcatggccacagg
gtgatggtggtggtggtgctggggcaagtgtgcactactaataggagaagatgtcaaaaa
aaatgaagcataataatagtgcaatttatccttgctaaacgtactgcagtgtgctataat
taaatatgaaaacctaaatttatctctatgttcggttgtcattaatttaacagggagtgc
acatgttctaatctaatggttgattttttttctccatgtgcagcatattaaaatgtatat
tagcctcaaggtgcataaacacaaaataatagaccaaaggttttggcctgtggagaaaaa
aaatccatgctcaaaggccgtcaagtagctgtgatgcaggggagacactcacttagcctc
attaagccaaagctctcttttgcttgtcttttgttctgcatgacagcagcctctttgttg
tataataattcattccaagttcgttccaagctaccgaaactggtgaactgtggccatttt
aatgagaagtattggtggtatgcataatctggaagccacgtgggccagacaatcacagag
cactgcagccagcaaaatgagatattgtcgaaatcacaaatttgtcaagttgtttttgga
cagggtattataataagcactaaaatatgcatcctattactctgcatctgccagtcaaag
atcactgtaatgaatgcgtgctgcagggtataaccaggccgttttcctaagtaaaacaaa
ccacagagtacagaaaagaattgtgtgggtttttttttttttttttggcattgtttgact
tttttttttttcctaatccttttgcaccaggagtcaggttctcctggcatggtgtccact
gctagcagtgaatacacaggccctgctggtgccagggagttaacatgaatacattgcttt
tttaataggtgtgcttaccatctgagaatacaaaacctcaaactcaaggcttcaattgag
tctactgaagaattcctgggagagaaaagggaaaaaggaggagaaaaaaatatctctccc
aatgatcctaagccttatgttttatccttttctacttcaaatggcttagcctttgggact
tgttttgttgtttgtttttctgtttgtttatttttgcttttttgtctgtctgttgattta
tttgctttttagatgaacctaaagctttgGGAAGAAATGGGTGAGATGCTA
Primer
(+)GCTGAGATTGTGTGATGTGGAG
(+)TAGCATCTCACCCATTTCTTCC