Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs65 ]


Position: chr16:51,958,288-51,959,688 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC101927364 - C16orf97

Timepoints:
e11.5

Publications:
A fair amount of ectopic expression outside of somite.

Expression Pattern
somite (6 out of 8 embryos) 

Embryo 1


Embryo 2


Embryo 3

Embryo 4


Embryo 6

Fasta sequence
CCAAGTATGGCACTAGGGGTTGATaaattgataatgtaggcagtgtgaggtttttcaaaa
atgtgaatctgtgccatcctctgtgtgtgtatgtgtgtgtgtgtgtgcacactgtgtgaa
tctgtgtccatgtgctcaaacctgtacaagtgtctgtggccaaaactgcaatgagataga
tcacctgaacgtaaatactcaggttcaacaggactaaacttcagctgtgactcctttcag
agcctcttttgtgctctactttcttcttgaaatctaaagcttctctagttctccattggt
agctgtgaagaaatgttttccctagattaaaaattgtgtttagattttcagcaactaagt
ttgtaaagtaaataaagaccttctttcaccaatttaaagtgtacaaaattattattttca
ataaaagtataaaatatctataatatatggaattaataaaatacattcaaggttcttcat
atttatcaaggcacttttttttttccttcaattacttgcacaatccatttccaggtgata
ccattgttggtcctcttatcagtgtcaataattccatttggcagccagcagctaattctt
ttcatgtgctaatgattaatcagacaagcctatttactaatgtatcagaatgcattagaa
acataaggtaatggcggacagaacatcaattcaaatataaatgaactacatttacattgg
atacctattgacttatgtcacagaatgaagtagaaaatacaatttacttgtaaaccatta
aaatgaatgaaaatagaatttcaaactccatcttcaaacataactttattggcttggccg
tgagccttaagggagtgcctaactaagtttaaaatatataaataacacactaattcattt
tgccataaaagagttagtgtctcaccaactgaacaccatggaatttacttaagttggaac
tagtacaaaataaaaagaggtcacagggtataatgtgaggacatgttagcattctcacat
tggggttttctgattttagctctcctctaacctatttttgtccaaaatcttccatctttg
cttgtcccaagggcactggcccatattttaccaatcaaaaatttgaaattaaaatccttg
tgagagtgagggtgggttaagtcagatcaaattataatagtaatcataatatagactaaa
gtactggaaaccaagctctataggcatctacattggactttcactggatgaaagggatat
tttaagatattcagagaaacattacaagcaattagataaacactggaaagtgaatagatt
tgacacacttagtatggaaagtttctgtgacactaataggattttttttaactgaaGTCC
AGATGTCTAGCATGAGATGGA
Primer
(+)CCAAGTATGGCACTAGGGGTTGAT
(+)TCCATCTCATGCTAGACATCTGGAC