Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs611 ]


Position: chr12:111,495,397-111,496,252 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: CUX2(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (8 out of 8 embryos) 
hindbrain (rhombencephalon) (8 out of 8 embryos) 

Embryo 1



 
Sections available
Sections available
Embryo 2



Embryo 3



Embryo 5


Fasta sequence
ATCTTCCTGTCTTCCTGTgggcccctcgctccccacttctgccagcagcctccccttctg
ccagaaagagtgactcccacctcaacagcctggaagcactccaactaccgtacttttctt
caaataaaagcagctaattaacattattctttaattattgcctttatcaacaaggggtct
gatttctaccagcaggatagttgctttcccttaaactacccaagtgaatgcttcagttcc
tggtgcttttgaaatgaatttgatgtcatctgcccagagtcacttaatggggacgcctgg
gtaatgactgaacgcgctaactccgttagcagccctggaagcatgtaatttggcccctca
ggcaacagcacttttgaaatctctggatagttttgaactctctgttcttaattaaatatg
caatttttcacggtaaccaggttaattcttttgtgttgtgttgtaatactgttaggaatt
ttcatagttcttattaaacattattcaggcattgtgaattccataattaaaaaaaatgaa
aagaacaaagcttgattcactcctttcttttccctggctaatttatcaaatgaattttgc
aaatttttctttctgtccccagacagtgtggcaagtgttttaaaggggaaggatttaatt
gccctgtagggattggctggttatgaaggatttggctgtttgattagtaaacccagttgg
gaatggtctaatgctccatgatcttaaaaattgtctgattgtaccctctccaaggaggcc
tctctcttcgttatgtagagcatcaacttcacacaagtgtgattattaggtagTGAGGAA
AGGGAAGAGAGAAAGA
Primer
(+)ATCTTCCTGTCTTCCTGT
(+)TCTTTCTCTCTTCCCTTTCCTCA