Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs595 ]


Position: chr10:76,177,765-76,179,000 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ADK(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (12 out of 13 embryos) 
midbrain (mesencephalon) (9 out of 13 embryos) 
nose (8 out of 13 embryos) 

Embryo 1


Embryo 2



Embryo 3



 
Sections available
Sections available
Embryo 4




Embryo 5



Embryo 6



Embryo 8


Fasta sequence
TGCCTTAAGTAGGAAAGAAACAGCtaaaagatacataggttattttgctttttaaaattt
tagcaaactattctgtgaatcttttgtgtgtttggggctgtttgtagaggaaaatttcat
caagcaacattttgggaacattggccttttgtactctttcctaaataaacagaaacttgt
actccccaaaataaaatgtttctttgtatattgttacctgcaagttattgataatggaag
gaacaccttttcaatccttagtcccctttcccccaacacagcttttagattgtcgataaa
cttcccagctcagtaattaactgagctcagtcattgcaccctgtatcatgtgattttttt
ttccagtggaatacattattagagcacttacacagccagtctagctgcagcagcccaggc
ggcaacagcagtgccatttttcacaaagaaaatgttgaacaggagccaaatgtttggtgg
cagtctgttgctaggaaatcaaggtcctgaggcgattaatgacaaagcaagcaataacaa
gaaggcagaattacagatttaaaagagaaaaaagtggttggtgttataattacccaaaga
aatccgcactcattaaattggctgtttttatgattgactttaattggaggttagctcaga
tatttagctcctttcccacccctttaaacacacacaggcacataatctgtagaactgcag
acttgtttttctaagcattgagaggagcttgccctgtaatttgatccccactgacagatg
cattttctatgctgccattttgaattaacctattgtagaacaattttcttcagccctgtt
gaataaaacatccagtctgattacctccgatggatttgatagagtaaaagaatgtacttc
tcattgaagtagattgtttgcatggactctactgattgtgaactctgccagtaagcacaa
tcatttgtaataaattttcaaagaaatttgtgaggaaaaggtaatgagagtcaccctttt
atagtttaatgtttggcacctccatcaaaataatataattcttataagacagtgttattt
ttccagtaagcttttcacgtggttttagaaaaaatttctgaatcttcatttggactattc
atatatttaggaatagagtcttgtatttacactctaaaatgaccattcttcctccccaac
aacagtattttagtGCAAGACTCAATATGCAAAGCA
Primer
(+)TGCCTTAAGTAGGAAAGAAACAGC
(+)TGCTTTGCATATTGAGTCTTGC