Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs59 ]


Position: chr16:53,726,316-53,727,556 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: RPGRIP1L(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
branchial arch (8 out of 8 embryos) 
eye (8 out of 8 embryos) 
nose (8 out of 8 embryos) 

Embryo 1


Embryo 2


Embryo 3

Embryo 4


Embryo 6


Embryo 7

Fasta sequence
TCAGCATAAAATCCATTCTGTTGAAaggaacataatcactgtgaagacttcagtgcagaa
cctgaataataaatttcaggttttgatgtaactattactgcctgtgaagaatcctttgat
gataattgaaaccactgggcaacaatctgctttatagcactgacaaataacagtttccta
aggcttatcatttaaggttagtaaagagaggacacatatttactccatatgttcctgaaa
cgcaatttttaacgcatgaccttatataggaatgctgtacgcacttaagtgtagttacag
attgtggatgtggtgggttatatctgcaatccacagtaagttaaaacttttgaaaagtgt
gttaagactgtgcagcatttaggtaatatattgttttcagtttctccaggattaagacac
actataaatataaaaatgttagaatgcataaatgcacacatataaagcccaatgaaaaat
tcaaaagaaaccaaaatgcaccaataaatgttgcttagtgctcaagaaacacttgtgttt
aatggtaaaaaataattagatgcaaaagtatcattttaatgctatctttaaatttggaca
taaattgtgcttttgacatctcaggagtttatacctttgattcttttaagttttgataaa
aactggttagaaagaacaaaagacagaaagggcacatgggggtgatgtaatatacacgta
cggaaaacatgcctgacagtgaatggaaaaatcttggcaggacaagaaagaaaaggtggc
tttgatgagagacacaagttcaagactttacaaaattggtcgcacatcttcaatagctga
ttctagtttatagtgaatctatttttataaagacccagacaggagattgaaaataaaaac
acacttcatttttctttaaatgggttttgctttattttagcgtggttatggacagaagct
tttacttaagggaacaaaagtgaaataaaaaaacctttaatagctttgggatgtcataga
acaaccttttttctgccctaagcagagtccgctgtaaatgcggtagtaatacatgtctat
ccacactctggctactcggcctacagcatgtggcatcagggagagctatgcataacataa
tcagttaagattgttttctctttcccttgaggcacatccattaagcatgctttataaagg
atacaggataataaaaACCAAGATCCAAGAGTACCACAAAC
Primer
(+)TCAGCATAAAATCCATTCTGTTGAA
(+)GTTTGTGGTACTCTTGGATCTTGGT