Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs586 ]


Position: chr5:50,481,472-50,482,478 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC100287592 - LOC642366

Timepoints:
e11.5

Publications:
Craniofacial enhancer activity persists at e13.5 and e15.5.

Expression Pattern
nose (5 out of 8 embryos) 

Embryo 1



Embryo 2


Embryo 3


Embryo 4


Embryo 5


Embryo 9


Embryo 10


Embryo 12


Embryo 17


Embryo 20


Embryo 23


Fasta sequence
TGAGGGCATCCGTTCTAAAATAggaaaaacataatctgtatgcgaggaaaactacaaaga
agcaataaattattgctgtaatgacatgctaattaaaattttgcttgtaactcatgtaag
tgtttgaagcccagcaaatttctcttttcatttgtgaagtgtgaaggtaaattgcccagt
gacagtgggacatcgctaacaagtacaaattgaataacatgctatcttgctctattagcc
ctgactagcatgtctgaattagatattcagcgcactccccattgtaggcctgattgataa
atgctaaggagaatttgtcaaaacaacaggggctacacccagtgggacatcaatatgctc
catttagtcacccccacagcacttcctacataggattgtcacataaaattaagactagcc
gctaaccagccatcaagcttgtagcagacgtcaggcagcctgtgttctgtatgcatatta
gtcacatgcttaacaatttgggctgtcaggacagaagcatgcagtgacctctggagcaga
ggttgaattttgcagctataccaaaacatcatgctcagctgttcaagattttagaccatt
tcctgccagatctgtgcacagatgcagtgccctaagctataatctgtagcagcgtccaaa
tggcaaatggcaccaggaagattattgcattatatattaagtaccacaagtctgtaaatt
ataagtaaactactgttcagactgtctcctccagctttcaggatactttcccttttcatt
ctttttaaaataaacctaataaatattgggtgaactggagatcaaagcccagagtttgaa
ttagccatctccattgctaattagctgcttgaatatcaaacagttttggaccagctgtaa
tttaataagccatgattgaggttggcctgattttgtttcccattgaaaattcttctcagg
tgcaagtttgtatgattttagaaTTCATGGTGATAAGTTGTTTTTGG
Primer
(+)TGAGGGCATCCGTTCTAAAATA
(+)CCAAAAACAACTTATCACCATGAA