Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs579 ]


Position: chr12:17,824,855-17,826,335 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SKP1P2 - RERGL

Timepoints:
e11.5

Publications:
Staining in ear region. Exact tissue identity not established.

Expression Pattern
ear (6 out of 7 embryos) 

Embryo 1


Embryo 2


Embryo 3


Fasta sequence
TTGATTTAGGTGCTGTGTTCTCAgtaaaactaactcattagaaaaatgttctgaaaccta
gttgatatctatttattcacttttgcagagggtttttagccaagacacattctccaattt
aaataaacttctttatattatagattacatcatgtataaagagaaaatgcaaaaacatgg
ttaacttttacatattaggtcattaaaaatccattcttgccttcctgcccattactacat
ctctttttcagacctgtcacccatttcatttaagcacttagctctcttctaatgaatgaa
ttggcatttcatattaccttattatcctacaaaacaaaatgcatactcaataacattaat
ggtaatttctcataaagacacattatcgatccgggagctacctgtaagcattgaaaattg
cagcctgcacacagagcctttcacatctgggtctgaagaattaaagaaaaattaaatttg
acagcagtaaattcacaggcacaatctaggctccaatttatatgcaaaatgaaatgcttt
atgaaaatttcttctattttctcacggagatttggaaaaaagatttcactaggtgcttct
ttctttaatatccctctacttaaatattatactgcagtcactgcagactctctttgatgt
ataaataatcaagttaaattatgtgcagcaaggagactagtgctctgccattcttatttt
acaaagtaatttctaccctagagggtcaaatttccctgacaaattcttaattactgtgtt
gcaacagaagcagaatctatttgtgcataaatcctgggcattcccatgtggcaagtaact
aatattaccaaccatttcacttggcctgttcactgaactccataattagataatactttt
gatgatggtacatttgaagtcttaatccatttaattttttatgagtttttttttatttta
atagggatatgttagtgaccactgcctatttaaaaatcattaaaattctgtccacagcag
taataaagattaaagatcactaatatggcattcataaccttgctggttttccagaaatcc
agggcttaaggtaaatgttaaaggtcatttaatatgttagtcactaattataatcctggg
taataggttccttttctaattatcatggtataaaagttctattgtttgggtctgtgcttc
tgatttttgtatttagcttttttttggaataagtaatcctggaattaagctcctgaacat
tgatgaaagtaggtaatgcttgatgattaactggataaaagcttatatttgaatgctgta
tgatatcttgccttgaagttacttacaaaagatgcagcatctttttttctaggaataagt
tcagggaaaaggtcattgtaaggttaatgcacccatattttaatatcaaactatgacaaa
tttgactacagcctttccgTACCCCTGCCAAAACATTAAGA
Primer
(+)TTGATTTAGGTGCTGTGTTCTCA
(+)TCTTAATGTTTTGGCAGGGGTA