Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs565 ]


Position: chr11:31,622,822-31,624,118 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ELP4(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (8 out of 10 embryos) 
midbrain (mesencephalon) (8 out of 10 embryos) 

Embryo 1


 
Sections available
Sections available
Embryo 2


Embryo 3


Embryo 5


Fasta sequence
CTTGAGCAGAAAAATTTGGAAAAttgttttttcctgtaagaatatatttttattttcatt
gttaattgaaaagattaaagtttttcatcagcaataaaattttcatggctaccttatgaa
tattttagctaccatatctaattttaatttctaaataaattaataacaattataatgaga
aaagcttccaattttatttttacattttaatgaattatttgtgttctatatgtaaactgt
ctcagcatgaaatcaattttctgccttgattcattccaaatctgagatttctatcacatt
aatattgtaattagaaacattaatagagacggcaacttaaaaagcatactttgcttcttg
gcaatttagcatatttctctgagtgcataggacttcaagaactttcagtccactaataaa
tttattaactcaaacttaaaagaagtgaaaagtctctttctttctctctccccatggcca
gtctgctaaaatagattattcatgcttatttgattcaggtaggcttttgcaagcttccct
actaggcctgggaatgtggtacattgaggccttttcagaggcttctgacatagaccaagc
ttttattgcatggtgttttattatagccaaatcctagtctccacccagtttgtaggcact
ctgcttattcttttgaatcaggaaaggttatcacctaccttaatccatgctgctgcatgg
attaaggacaccagtgtgccccaggattctcaaagaggatcctggaaacttctggttttt
tcttttttgctgtctttactaaattctattgggcctgagggggatttgcatctgaaatgg
gcaacctggtgtttttctcaatgaagacatcagatcaaagttcagttagtcaaggccttt
ctaaaacattaagggggcttggacttacacaataaaaagatgagctctagcagagattgc
aataaaaacattctgaactataatccggataaagaatagattataggccaaagaacagac
cttgtttaaattgctttagactaataactttacattttttaagtttgtaccctattttta
agaaacattttaatattatatattttatttatcaatagtttcatgataaatggataaatt
atgttttgggaacaagaattctgtacatattggattgaaaagattagattgaagcaaact
gatagcatatcttattaatgaaagtaagtagtaccttatggagggatgaacggtcatttc
attttaaaaaataaaTGTCAAACCCACAGACTCTGAA
Primer
(+)CTTGAGCAGAAAAATTTGGAAAA
(+)TTCAGAGTCTGTGGGTTTGACA