Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs550 ]


Position: chr7:13,506,207-13,507,276 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ARL4A - ETV1

Expression Pattern
branchial arch (3 out of 5 embryos) 
forebrain (3 out of 5 embryos) 

Embryo 1


Embryo 2


 
Sections available
Sections available
Embryo 3


Fasta sequence
gAgtTTTGGCTGTGACTTTAGCCATTgctttgttttattgtaatcagatacattggcatg
aaactacttgtaacagattccaaaagtatatgctgggctttttattggcatatcaaacag
ggaagcattcaggccatacattagcaagcagccaagtaattaataataacacacgtgaaa
gaaaatgaatattttggttgagaatcagaatgagaagtaagacaaaggcctgggattcgt
gtccttgccctcagcagcagcaaaaataatgttatgaatagcatttaacttgaatttgca
gcaaactgctgcttttatcataaacaattgccagatggtatacattatctttcttttttc
tcctttcacaaaagcagcattaattgcagagcagcccagggctccactcagctcatcagt
gtgataacacttcatgaccctgattagccgtcagtctactcaattaaaaagatcatttag
acattcacccaatcatttgcctatcgagccacctgggcctcaaccaggggctccattttt
aacattctcctgccctctctcatcttgcctagcttttttacatatctccaaaagacgtaa
ttgaattaaataaagcgtctcaggggcagctgcaacatctgctgtttgtggtatgtcaag
ccttcagcattaaaaacagttacatatgctctaaattagcaggtcgcagagatgaaacag
tcgatgatagtgtttttgtgccagcgtgagaagcagctcacagctgtgtgcaatttacaa
ttaaaggctttatcagagctcaattgtactagtgaatcaagtggtgagaggtcagttagt
gaattagaccaattagagcttgtacagttaaattatctgtcttattacctactgataaac
agccttgtcatatctttgctggaatgatgaagctgaatgagttttatgaagtgataatac
aagttcactgtagtggaacttagtgatatgtgaattcaaaatctatagcaacaaaatggt
tttatataaccttttaaaatagctatatAACAGGGAACTTTGAATTGGTT
Primer
(+)CACCTTTGGCTGTGACTTTAGCCATT
(+)AACCAATTCAAAGTTCCCTGTT