Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs543 ]


Position: chr5:50,960,132-50,961,567 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ISL1 - PELO

Timepoints:
e11.5

Publications:

Expression Pattern
ear (7 out of 7 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Fasta sequence
aAtCCACGGGTTAATGTGCATAAGGTtgtgaagatttataagatgtggacagttattgta
ttgattaaaatgcatatttttccaaagcaagtatatactttcactttaaaagtcaatgta
aataacaagttagtattcaatttactaattatgttagacttagcttgttgcagatttgag
tgacagccgtttttctgattctgtctcctctaccctcactccagattagaactggcactt
tcccctatgcaaatgaacatctaattagagacacctcccagtcaataagccactttctta
tcaccagttatattacctgacaagccctttctctgcagtcttggcccaccaagaatcttc
attcattttctcttcttcttctctgcaaagtgaactgatcccgcataatccctggaataa
tgtagcttctcttgtggaagagcagcttccctcgcccccttttacatcaagctaatggag
ccagtaggtatcctattgatcttttctctatatggtttccacaaggatttgacagacttc
cttacaggttaaacatccaggctttctgaagtggctataaagctttgtttttgatttttc
taacttttttttttgaaacccttgctcatctgtaatctttaaaagctcagttgatgccat
gcacagcaaagccttatttctttgcagaactaatctcgacactgtctagtgttgagtaca
gttgtctgattcaaatcttctgttacaaagcagatgacatctagctagatgtcatgagaa
gagcctaacaatgacaattcacttatcccttagaaagaatcaattctcccacaatgcatc
tgtcagagaactctcactcagtaaaagcaatttttctagctgtctgacactgtaattgct
cttaaattttcaatgaacgttttacaaggactcccctgaaccatgatgaaaaacttaact
tttttctaaaaatgagaggctgacaggatgaaagaggtctttctctttaaagccttgctt
gcttgagtaggaattctttcatatcatcaacaagctgttgaatagaggatagattacttt
ccatttatttcatcaatcagattaaaggctctccttcacaatgccctttaaacaagagct
gtttatgatgtcctcccaggtttgactttaatgtagtattaaatcactatggacagtgga
gtcagtagagaatataaatatgacgaatatctgacaatatttaagtattgtatatatttg
ggtcattatcttcattcttgccacaaaagagatgtaaacaaaaaagaaaaacaaccatag
atttgctattcttcagtctgaaaaaaattcaacacaattttcctgtatgtatcagtaagc
agaaatgccaagcatgctagtgattttttttCTCTCAGATCAGCAATTTAAAAAGA
Primer
(+)CACCCACGGGTTAATGTGCATAAGGT
(+)TCTTTTTAAATTGCTGATCTGAGAG