Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs52 ]


Position: chr16:54,143,854-54,144,867 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: FTO-IT1 - IRX3

Timepoints:
e11.5

Publications:
These transgenics are embryonic day 12.5

Expression Pattern
dorsal root ganglion (3 out of 5 embryos) 
trigeminal V (ganglion, cranial) (3 out of 5 embryos) 

Embryo 1



Embryo 2



Embryo 3

Fasta sequence
CAATTTGGAATAACTTTCCCTACCCagtaaattgagcattactctaggattctgagacag
agagaaagcacaattttaaaagctttgcagagttcctttgtaattagtcgcagctttcct
tgaatattaattttccctgcatccctttcaagtggttgagagactgtctctacaactaca
gagatgcaccctcagaacaacgacagcaagcggcatggtctcaaacacctatgattaagt
agtctacagaacgcaccctctgttcttcagtgcagtgtgtagcttatcagtgcaaacagt
ttaatatttatgctaagaggattgtcaaaagcagcttctgttgctttaattcttgtttta
aataaataatgagaacatttaaacacattactcttcttggggccccggggtcagctaatc
ttattatttatgaagtgatgtgctacataatagtacttagtgcatgttaacagacgctat
tatcagggccggatgcagagagctgaagatatattagaatgttatgtgtaatgtacgacg
gattgagtgcataggatgccggtgtagcaattaaccacactcgaaaataggtgtaaagtt
gaagtatgttttccccggggggatcccctcaccattaataattccccagagaagaagatg
tctttcagttaggaaccctctctaccatcaggcttggaaatggggccaggatattccatt
ctttgatctcttcatagtcagtcctacacagtcagaagacaaatagtgagcatgaccact
ttttaattgatttagacaaaaatggagagaaggcgggggtggagggaggcacatgtgcaa
tgctcccaagtgtcctcatagtgtttggttttgatccactcgttttcactgccacgtact
ccaggagagtcgagaaattgttcattccttaatgcaatctgtttccttctctctgatcct
cattttgcagataaataaagctaaagccaCTGAGTTTTCCCAGGTCACTTTTTA
Primer
(+)caatttggaataactttccctaccc
(+)taaaaagtgacctgggaaaactcag