Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs511 ]


Position: chr10:103,527,193-103,528,393 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: FBXW4 - FGF8

Timepoints:
e11.5

Publications:

Expression Pattern
tail (5 out of 6 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5

Fasta sequence
CTGGAGAGGGCCTAGTGTGTgggtcggctgggctcacacgcaggccctcagtgggtgtgc
acggtcaagccttgaagcagccctcagcccgcccctaggccctcgcagccagcaccaact
ctgggacggagtggcagggggccttttggctgagagaagcccagtcctcctccattttct
gggccttgcaacagctccctgcttgttttccccgaaataaatgggctgagcatattgggc
cggcaataaccccttgaaatcagttgttatcacagttaacaaccagtttggcttcagttc
aggctgttaactatcaaaccactaagtgccggtaatgattgattcttggccagttgcagc
ttgagtgggctgtaaaaccccgttagtgagggctctgtggaggcagcggctcaaagataa
acaagttgatgggtgctctagcctggcctagccccagtgctctgggcgcagctcccatgg
gtccctggcctggggtcctactgggagtcaacctcttcccaaagctgcaggcaacctcaa
ggaccaggtcccacccttctgtccccctccacctcacctttccctattcaggtgtctctt
tctagaaggcaggtctggctctctggagagctcccttcttcttccaagatgtaaacatgg
cacaatcccattgccaccaccctggaggactcaggcctccccaacctgggggcatgagga
ttagctttagccagtgaccagcctcggcccagcctggccccacgttgtggccaggatcac
aggcagagagcctgacattccaccccctgccccagactccctcctactcagtgccttccc
ccaggaattgctctcaaacaaatgaaatgtgggtaattactgggctaggggctggacagg
agaccgtgcagatgaaagcgtttcctggacggtcccttcatttgcatggcatcagaagct
gctcagaaggtgtgacttttcccacagtgagaccccagctccttgcacaataaagccagg
ctgcttacccagaattaattaaagggggaagggagcagaggaggaggcgctaagagctgg
gggaactggaagagagacatctagggccccttcgctacatccagtgtctacgcaccagca
gaaacccactctctccagagcccctcaccgcctgtggcaggccACGAGAGGTGGCTGGAC
A
Primer
(+)CTGGAGAGGGCCTAGTGTGT
(+)TGTCCAGCCACCTCTCGT