Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs51 ]


Position: chr16:54,323,420-54,324,336 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: IRX3 - CRNDE

Expression Pattern
dorsal root ganglion (5 out of 5 embryos) 

Embryo 1

Embryo 2

Embryo 3

Embryo 4

Fasta sequence
CACTTCACAAGAGGGGAGTCACcaggcccgcttcctgccccctcctcgcccagcctcacg
gtgctcacacgtccccgtcgaggggagccgcggcagccctcggactcccagccccggctc
atcttctatccttccctcccaggccctaagtccccgggctgcggtgcgggccggcgatct
ctgagcttcctgcaggcgctgcggcgcgcgctcccaccgttccctccccctcgcgctcgg
gttacaggttaatgaaatgctcgttttcctcagtcatttgttttgttttcctgcaaagtt
ctgataagtagctaaccaacgaagcttgtaattacaatcttacagaaaccgggccgatct
gtatataaatctcaccatccaattacaagatgtaataattttgcactcaagctggtaatg
aggtctaatactcgtgcatgcgataatcccctctggatgctggcttgatcagatgttggc
tttgtaattagacgggcagaaaatcattatttcatgttcaaatagaaaatgaggttggtg
ggaagttaatttctctccgctctgtgaagcgtagacaagaatttaatgatttaattacag
ttgtaagccctttccatgagacttaaattgagctgagaatattttttttccttctctctc
cctctctcccactttcgcgttctctttctccgctattagcagccgcggactcctgagagc
gtggcctggcgtccgcacagggtggaattcgtatttggccaggaatccggactccgatca
tcccaggagacgcggaccgggggcctccagagctctccggagcgtgctgccgctccccac
cagccaccagggactcggaggcccttcctgggtccggagaagcgacggggacaCTTAGGG
GAAAACTTTGCCAACTT
Primer
(+)CACTTCACAAGAGGGGAGTCAC
(+)AAGTTGGCAAAGTTTTCCCCTAAG