Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs43 ]


Position: chr16:54,575,878-54,577,925 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: IRX3 - CRNDE

Timepoints:
e11.5

Publications:

Expression Pattern
midbrain (mesencephalon) (6 out of 6 embryos) 
nose (5 out of 6 embryos) 
tail (5 out of 6 embryos) 

Embryo 1

Embryo 2

Embryo 4

Embryo 5

Fasta sequence
GCTCAATGAACTCAAAAATCCAGATAactgagtgtagtacaaattagcaaatacgggaaa
tggccgatggaaatagcacacatacttctcccaataagtttatatgcatcctctcattgg
gaaatgaatctgtagaaagtctgcctgtgtctactcagcctgctgagtccagggtaagtt
tggatttgagtcctctcttagaggatacctatggcattttgatttatccacaggaccatt
caatcttaaatggaacacacttaaaataatagaaaaacacagttaagttggaataatgaa
agttgaggacgtcagggagatgaaataaagtttacgaagatatgccctatcataaaaagt
tcaccctctctgtaatgaagcgtaggaatatcaattgactgaagtgacagctagctttca
gaatattcatgaaaaacgcagcctcctctcatagatgtattaaagtattacttaccccct
tttgggaaagccatgtcaccaattccaggagtgaatagtgatgcataaaattgaaggaga
aaatgtggagaaaaataagcacacatcagaagcagggtcaagaacctaatttcacagtga
cacactcgtaatttggctttgaaaatttttgtcaattctaaattcatttgaaaaagcata
gctcagaaatgccggtgtctgaatatgagatatgccagtgtctgaatatgagattccaat
atttatagtacagtttacaaatacattacccctgtcacagtgaaataagtcacatactta
catgctgagtggagtcagtccaaaggtgtaggcatcagggaaaaagataaggagacaagt
aattagtacattaatcttttttattatatcatttttcagacatatatgatcgtaatgtaa
attagaaataaaggagggttcatggaaaatagaattaatttcgaggaggtcaatcactct
acagtaactgcattacaagcatggtgtaatttacggcaacatttgtccattttcctgcgt
gtggctgattacgatgctctgctctttgctatcagttgaaagtcagcttgtgcgataaca
ttctgcgtcctaatgaaattcatttgcagtacaaaaatttgagtgaatccaacaagggct
gttacaggccttaatggcattctatggattattgatttttgatttagtttctgctcaaga
gaagcccattttaacagcaccattacctccataacgattagagacaaaaagttaattatg
taattataaagccaataacagacttgtctggtttactttgctttagtcagtttaaacatt
atctctcgtgtgcacatcataacaggcggagtgtgagaagagagattaacgccatgaaag
cagatgtgaaatttaattctccaggccatcgctgtctgggaaaccattaagtaatcacag
cattctccctctattaaattcacggctgccacttcacacacaaaaggtgggaaaaggtgc
agtgagccttccagtcctattggagtgtaacacagacccaccctgaggcgctgagggaga
aaaccctgctcaataggatgcctctgtctatttgaaaatgaaaagcttgggaaaaattaa
gcgtatgatgtcgttcctaagataaaccaagggactgttttcaccttgaaaaggagctag
agctactgaaggttggcgggtttggaaatcagaagtcagccctggcgaaggtcactagaa
ctttctaatgccatgcctcgtcttgtgccggcttgtaagtgatgttctgaaacataaaca
ttttaataaccatcatccttccaagagcttccaaatggacagcctcaaatgaaatctcac
accttggttagcagtggaaggttgccgcgctcaatattatttgtcttagcatgtgtgtgt
gtgtgtgtgtgtgtgtgcgtgtgtgtgtgtgtttcttctccctcctcttaagatcttatc
aaaatcatagttataaacaactacccctagctgagagtctataTTTCTTCATAGGGTCTC
ATGACCTC
Primer
(+)GCTCAATGAACTCAAAAATCCAGATA
(+)GAGGTCATGAGACCCTATGAAGAAA