Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs422 ]


Position: chr2:172,955,879-172,957,052 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: DLX1 - DLX2

Expression Pattern
forebrain (6 out of 7 embryos) 
midbrain (mesencephalon) (7 out of 7 embryos) 
nose (6 out of 7 embryos) 

Embryo 1



Embryo 2



Embryo 3



Embryo 4



Embryo 5



Embryo 6



 
Sections available
Sections available
Fasta sequence
AGGGGGTCTTCCTAGGTTCAatttcccctaggagatgtgactttgctagtgcgaagattt
ctgtccggcatctgactcaggtcccccagacggcagctagggcccaatgcctcaagctac
aggcaaaatctgtttggtcaagcggattgtaatactttgagatattagcttatactaatt
taataatctcttgctaacagttcaaatagagaaattattagttttagctcaacgaaaacg
gtctttagttaggctttattataattataagcggttgtactttttaaaaatgttaatctc
aatataggcctaattaatgctgccttgttactgacaagtagttcatcaaatatctgattc
aaagattttcataatgagtatattaattaaactatgaataatctaaaggtggttatattt
aaacaatacctcattataatgattaaatactgatttcgaatattatgtcttaacaattgt
cacttagaaaacacaacctttccttatgtatgagtctgtaatggcaaaatgcaattttgg
gatttttttcccttgttcaaaaaatgtgaaactcattttaaaacacttctgaaataggtt
acacacagcttaatgattatcaaaatgactcttttctgcaaaaaaagaccccaaagtgcg
cgtacagctgcaaacccaagagggtcagcatcatttcactgtattctcttcttgattaca
agccgggcccatcaaacacaacataattacagtaatttcaggtttatttattctaatgca
gtttccccatctctctggtaattatgagcaattttttcgcccagggaatctttttgcatt
aacaaaagagataacgcactgaaagccaaatttgctgtgcattgagaaaaggaaaaaaaa
aaatcaaataggtgcgagctgccatctctgcaattctctggtaccggagccggcaaattg
cttgcaggtgtatggagcaagcttgtcaatggccaggcctccaaattagcaaatgcacag
cagcaaagtaatgaagacagacttagcaaaattgccaaacaacagatatccctttaatat
cttctctcacccacactagctctaaaaaggggtaggggtagggagagaagcaacagtccc
cagccccctcctcaCTGGTCTTGGCTTTCAGGAG
Primer
(+)AGGGGGTCTTCCTAGGTTCA
(+)CTCCTGAAAGCCAAGACCAG