Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs421 ]


Position: chr2:164,843,797-164,844,783 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: FIGN - GRB14

Expression Pattern
dorsal root ganglion (3 out of 4 embryos) 
neural tube (3 out of 4 embryos) 

Embryo 1


Embryo 2


Fasta sequence
GCATGCAGACACACACACACacacacacacacacacacacacaatgtatttctgcttttt
ttacgacagtttaaaagaaatgctgtgtcagtgttttgatgcatccagggactgaatgta
aacaacatggtacaactctgaaaactgccatcataaaatattttaagagccagaatagag
taaaataaaataaaaatgtctttttatgtgatatctcagagtaattcaggatttatggta
ccttaacctttagaatccaaaatattaagctatgtttcttagagataataactcggttgt
ccctcacttatgtgtcttagataaaagcctactgccacagaatccatgaatgctcaaata
cccttgcgggcctttagtagtaaatcttatggaatagcttatggccaatgtaatggccca
cagtagcctgcgaatatcatgaattctaataatacttacatcagtagaaacatgaagtaa
tgtctccattgtaattaaatgatgtatttagagcagtggactaaatggtcccctagtgtg
ttggtgatatattctaatagtcttctctttacagccccacacggtaatattcatgcttta
ttctggagggctttgcttctgactgaacatttgaattgcaacattaagtggtaaagtgga
ttacagtgaggccccatgaatatggatcctgatcaagaaactaagtgcttaaaaaaataa
aatgttactatttaaatagagtgattacaaaaacatttttatacggaggaatgtcaggag
tctttgccgcacttcttattctatgttcccgaagcagaacatatttgccacaattaaaaa
tttagtagggtgaaacatcagaccttaaatcacagtaatttctccttcacttattgaatt
taatttgggctgtttgaggtacaaattagttgtgataataattacattattccattttta
aaacatgTTCGTTCCCAAGATTATGGC
Primer
(+)GCATGCAGACACACACACAC
(+)GCCATAATCTTGGGAACGAA