Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs411 ]


Position: chr2:156,726,581-156,727,605 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: KCNJ3 - AC093375.1

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (7 out of 9 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


 
Sections available
Sections available
Embryo 5


Embryo 6


Fasta sequence
GCGTAACATGAATTTTATGATGGAATCATATGATTATATAGATACTGCTA
GCTTGAGACAATAGGAACTGGAATGCTGTGGCCTGGAATCTTGTTCTTTA
TGTATTAATAACAGACTTCTGAGCACACATATTCACTTTCAGATTTTTAA
GCAATTAGTTTGCAGATGTCACTAAATAAATGGCATTCATTCCTTAAGCA
GGAACCATACCTGTTAACCATCTCAGCCTATTCTAGCTTTAAAGCTGGGC
TTGATGTGCACAGCATGCTCAAAAACTGTACTCACAGTTCAAATGAGCTG
GATTACAGACCATGACCACTGAGACCCTCACATGACAAAGCCTTTGTGTA
ATTAATATGCAGGGTAAAATGCTCCCTGGACTGCTGCTAAAGCGATTTAA
ATCATGCACATAAAAAATGTAATCACAAATTTAGCATGGTGGACAGAGTA
GTCACACTGGGCTTGATTGCATAGAAGGTTCCAAGTGTGTTTTAAATGTC
CTTTAAGATTGAGATTAAGACTTGTACTTACAAGATGCATATTAATCTAA
AACTCAACATTTTTCAGTGTGGGATCACAGTAGGAGAACATTATGGGCAA
TAGAGGTTCATTCTAATCCCAGTAGGTAATTACACTTTGAAATAATATTC
TTTAATTAAATCTTGTTTGCAGTTGATTGATTTAAACACTAAATCTAAAA
CCCTAAATTTGAGTTTTTATCAATTTTTGATGCTTATTGCACACAACTTG
GGCTTTAATTGATGTTTCTGAAGTTTTAAAGCCCTTGTCCCCCATATCCT
GGTTTAGAATTTAGTATAATTATCAACATCATTCTTTAATACTCTTGATG
GCTTCTTCTGGAAACTCGGTAAGTTTGAGCACTTTCACAATTTTAATATA
TACCTGAAAGGTTTTTAATATATCACAATTCCAGTATTTACATACATGAT
TCTTCTATCACACCTTTAATAGACACATAATCTAATCCCTTCTCTGAAAT
ACTGACAGAGGGTTCTATTTCCAAA
Primer
(+)GCGTAACATGAATTTTATGATGGA
(+)TTTGGAAATAGAACCCTCTGTCA