Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs4 ]


Position: chr16:80,372,593-80,373,755 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC101928248 - DYNLRB2

Timepoints:
e11.5

Publications:

Expression Pattern
hindbrain (rhombencephalon) (10 out of 10 embryos) 
midbrain (mesencephalon) (10 out of 10 embryos) 
neural tube (6 out of 10 embryos) 

Embryo 1

Embryo 2

Embryo 4

Embryo 6

Embryo 7

Fasta sequence
gtgaCAGAGACAGACAGTGACAGAGACAgattttagaatttgaacaaaggtaaataagag
aaaattggaattcacaagatccttcagaattgggtcacctcaaggtgggaagtcaaacca
gctattctgcaaagccctgtcatcaccttttgcagttcagtagcagaacctgcacatgtg
cctccaatctgctcccatttctgtgtatttaaataaactaagtcaggccttttatgccct
tcctctgccacatgcttctcgtgcatgagatcagaggtatttgacaccatgtactcctgt
ctactaatctagcctctgcgaggcagcgatgataaatatcattgcagcagttctcattag
gactgtttaccatgtaccatggactgctacatttattttccccaccactctttaaatatt
atttttctcattttacagattagggaactgtagctcagagaagctaaataactttcccca
aaccacacagctattgaagtgacaaaattggaactcttatctgtccaaattcaatgccta
tatccctaacacctttaataacacaagatatgagaatatgtgactgtaccttcacatttg
tagatctaaagtagactttgaggaactagacttcacctacccaccccagcacaggaatcc
aactagttaaatgactctgattttactctagaaagaaataatcctaataccaagactctt
caattactctgtgcaattaagtcctgagtgcttgtttgaacaattaactgaaataattat
aaatgtatctctgttactacagttgcatattaacaaaggctcagggccaattaatcatta
ctccatcaatatctaatttgcataaacctattctctttaaagactccatggttggggtga
cagggctccctcatcgattatggaaatatccccatcaaacttccctgaggccgtcaaaag
gaataaaaggggttgtctgtcctcagctgctcagtacccctatccaatcctcccaggggc
agggaaggatggagaacaaaggggaaaagatacaattaacatgcacttctccactgggag
agggactgacagggctcaggttatgaggatgatggtcagagaggggcatctagcccaccc
gagGTCAGGGGAAAACAAGCATG
Primer
(+)CACCCAGAGACAGACAGTGACAGAGACA
(+)CATGCTTGTTTTCCCCTGAC