Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs388 ]


Position: chr2:7,774,393-7,775,070 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC100506274 - LOC101929551

Expression Pattern
forebrain (8 out of 13 embryos) 
limb (10 out of 13 embryos) 

Embryo 1

Embryo 2

 
Sections available
Sections available
Embryo 3

Embryo 4

Embryo 5

Embryo 6

Embryo 7

Embryo 8

Fasta sequence
ACCACACCAACTCTGTGAtccacaaaaatcttgcatttaatacagcaacgacacctataa
tggggaaggggtgggggtggggaggccgcacatttcaccatttccatctagatgaggagc
aaacaaagagataattataaactgtttctcttattgttgcactcgcattagacatgtgca
tctctctctccctctccctcgctcgctgtcctttttttttttttctccacagaaaagtaa
ttctgttgtggagatggcaccaggtgcacggggtgacctcacacacaccaaatcgggagc
tgacatccatcacactttgaaattttggatttcatcatttcctgatctttctaaagggat
cacagcacctggccctcacagctgtagttcatttagaaagcaatttaaaaaccgagaaaa
aagcaaatgacatcttgctgcctcagccttgtcattaagtatagcagaatggccttcatt
tatgaggcacatggctaagaattaatatctttcagggctttctcgagtagagattacaaa
aggtttgaaagaccactaaataattagtggtatgactgaggcaagcaaaaaaaagggggg
gaagaatccctctttttcgttctacagaagaaaatcagaaattacactgactttagtgTG
TCCTAAATGTTGGGAGGC
Primer
(+)ACCACACCAACTCTGTGA
(+)GCCTCCCAACATTTAGGACA