Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs385 ]


Position: chr19:31,587,058-31,588,070 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ZNF536 - TSHZ3

Expression Pattern
dorsal root ganglion (4 out of 9 embryos) 
neural tube (4 out of 9 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Fasta sequence
ATCCTGTCCAGCTGAGCGTAgacggcagtagccagggactggcagcacaggctgtgtgac
cggggcagggctgggagagaaaatggccgccctgtcgccaggtccttctgtgtgtggccc
tgtcaggaaggagccggagctccggccggggctggctggctcccgctaagtactaacgcc
acggtggcggtgggggacaggagatgagagacagaacagggcagctgcaaatggaaatca
ccctagggaaggttacaactagataaagttttcgacaataagattccagagactgctgac
gggagcaaagctccgtattttagtctcagtacaaatttgcttcaatcttatacaactccc
atgcagcattgcccacagctgcatgctgtaaacaacaaacaaatctatttccatcagccc
tgctgatgccaggagaaaagtgcctgagcagaagacatgcacagatgcaaaccctcacct
gagcctggcgctgccctccatttggcctctctaacttaatatcgttgttacaaagctatt
ggtctcctggtagctagctggctcaacgcagtgcctcttcttccagctaatctgacaact
ccgatccaagaagcatcaagggcccaattaagaagacacatcttatcaaggagcttattt
tgcataacagaatacaaatgacgaataaaaatttaatgtttaataacttagtacaaagag
ggctgttgatatagaatgcctggaatttttatggaggctgtcagacttgtgataaaactg
ttatataggaacacttggcaaaaaacagcgtagaatttttcagtaatggtgtgtgcatga
tattgcattaattcttgatagggaactaactgtaagccagtttgagtttcagtgtaagat
ggtgtgtgtgtgtgcgtgcgtgtgtgtgtgtgcatgcgcgtgtgtgtgtcgtgctctatc
cagaatgctctgagggtgtggctggacatgcacCCATGCCTTTATGGAGGAGA
Primer
(+)ATCCTGTCCAGCTGAGCGTA
(+)TCTCCTCCATAAAGGCATGG