Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs382 ]


Position: chr19:30,565,950-30,567,016 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: URI1 - ZNF536

Timepoints:
e11.5

Publications:

Expression Pattern
dorsal root ganglion (3 out of 4 embryos) 
neural tube (3 out of 4 embryos) 

Embryo 1


Embryo 2


Embryo 3


Fasta sequence
AGCAGGAGAGCACTGAATGgcgagccactggcccctcgcccgaccttcgtgagccaaggc
tgagtttattgtcagaaagatgactaagaaatccccgacacagtgtatcatcagcattat
gattggagaaacaacacctacaaaatctatgattcattaagtgtaaccaatatataattt
aaaacagtgggttttgtcaaataatgtgaggtcagcataattttctgcctattactaata
tctataacatctttgccttagtcagctctatttaaatatgcaatcatttacagcttttga
gaatatttctgtgtactcccaatttccaatattcaactacgacaaattttatgctgacat
caatagcaaactattaaagacagtatttcattattggtttttcatcccaaaagttattta
caattatatactaagcactaatattaaaggaaaccatttaaatgaggtgctatctacttt
aacaatatgtctgtcacagaatgagattgtgtttaaagattttatcaagaaatggttgtt
tgctgaggttatgttttgtccatgaaatatgcatttcatatctctttcatttcattaaca
taatttaatttgtgctttgcattttgtgcataatacatatttgatttacaaaacaaatat
ttccattagaaaatgaatttcatgcaggcaaaaaagcagaaccaaatgatgtattgaagg
aaaataagaagaaatgaaatgcattttctcagtctattaaaaaatctatggcattgacag
aaagtgcacttagtgttacgtttaaaaaatagcacatatgtcaatgtattaacaaataga
attggaaatacaaatatttccctatatcaagccaagaatctctttattttaattgagttg
atttaaaagcccaactacaatttaatttttatttcatgatgtggtgctggggctggtgct
gttggaactgcgtggggttggcggttgatggaagaagatagttgaccttaaaaatggctt
ttattgacaatggagagacatggttgaATAGGAAGGAAACGGGAAGC
Primer
(+)AGCAGGAGAGCACTGAATG
(+)GCTTCCCGTTTCCTTCCTAT