Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs381 ]


Position: chr19:30,494,614-30,495,503 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: URI1(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
eye (5 out of 6 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Fasta sequence
ACAACCCAAGGCTTTCACTGatacctttagcttagttgcacagtatttatatgtggatag
acttttaaaaatgtacttagcttacctacctgccatttttaatattttccagtcttcttg
aaaaaagttattgatttgacctcctacctaaaataatgttctttagatctaaagctggtt
agacacattatctgactgagtttactgaagcaaaaacattccataaccttaaccttttcc
ctgaccccctgcttttaacaactgccgacatagttttatgctgttatgtgaccatgctcg
gatgaaatctgtcaaacagctccttgagttattaggctgtctgagtctgacctttctgca
atcaaagatatatgacttaagggctcagatttgccatggcaaccggtccaatttgctgcc
gtgagaaaaggtctaattgttgcagaaatttaatgatctagagcgacatcagggctgtga
gattttatgaactgtttacaccgtaattttcattttgttaatgcagtcttttttttgtaa
cccattcatggctagagcataagtgattgtgttttatttaaaatagcattgcatagcatg
agagccgtatcggagaacatgtgccactctcgagaagcccttcatatgtggtgatatttc
acttttaactcccttccttattttcattcttttaaaagatattttaactgcttagacctt
tgccagacctgcattcatcattggtagagaaagaactatgtacttttctcctccatcctc
ttctgatctgcttactgattgagtgcctgttgtaaaacagtaggaaatcacagagcatct
gggggaggaggtatcatatcactgtctattATTCTTTATCAGCGCTTGGC
Primer
(+)ACAACCCAAGGCTTTCACTG
(+)GCCAAGCGCTGATAAAGAAT