Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs37 ]


Position: chr16:54,650,598-54,651,882 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: IRX3 - CRNDE

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (5 out of 5 embryos) 

Embryo 1

Embryo 2


Embryo 4

 
Sections available
Sections available
Embryo 5

Fasta sequence
CCCCTTCCACCTTTATCCACAatatcctcgagtggacatcactggggttcctctgaatga
ctgagttgcctcttcattattccgcccaagatgtcagctaaggctgtttacaaatccaag
gattctcttgccaaatatacagtctgttctccaagctttcatgttataacgaaatgagta
acaagcaagacatcttaatatcctattctgctagaaagtgagatatttcccctccctcgt
tcttaacagataaattaatatcatcaaacattctgaaaagatcttttatgaaaacatctc
acttgccaaaaaagaaaagttgtattataaaactggagaaatttgtttcaacttgttaaa
agccctattctcagccatgaattcggttcccgttttttttcccccttcaattaatttcac
actaatccatttctttatcaggcgttggagtgaatgcatgtggatcgagtgatgaggatg
agggggcaatggaggtgtttggctctgtaatttcatccttgaattttgtgattactaaca
ggacaacttttttaatttgctcttttgtctggattccctggctgacaatctgctcggtga
gctcggctttttaatcaatcacctacataatcaaatgtcactggctatctgctccgtgta
attacttttgcaattaaaaatcaacctcaagttgcctcatctaattagagggatgggcag
attttcatctagattgattttttaataaatattgacttaaaatgccataatctcatcata
ttctttcattttctttgtaccaaaaatcaaacaaatggaagaattagcaagcagaaggaa
tcgagggacttcaaaagcttctgctggttcagacacacaaaactatgctgtacagaagcc
cagcttagcttgcctaataacaacactcaatagcttccaccttttattggaaaaaagaac
aaagcaattcaatgattatatttcacaccaacattgttgcaagcccaccattctaagagc
tcctaatttcatttattgtactgccaaagacaatcatttctatgaatgatattatttcct
ttaaaacaatcccacacatgctactagaattttttagcattatgagaaaacatataatgc
ttaatgctggaaccgcaaccactgagttttcttaaacatatgaatgccactacagccaga
taacttccttgtctttgctgccgtgtgtcttttatgtattgtaattaaaacattgtcaat
aacaCAGTTCGTTGCTTTTTGGTTG
Primer
(+)ccccttccacctttatccaca
(+)caaccaaaaagcaacgaactg