Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs335 ]


Position: chr11:131,867,949-131,868,377 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: NTM(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
limb (5 out of 7 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Fasta sequence
TCCTGGAGGCCTTGTAAATGtacagaccatttagactttaagacagtggggccacttttc
atctcaggccaggctgctgcctggttttacggggtcataaaagtcctgacaggagtcata
aaagcctccaattgcactgcagaaacccttggagtatattttaagggcccctgagttttc
attttgctgcttttatggggactcgtaaaagctgcgtggagtgagcccactgattggctg
ctcagcacggaggtagttaaaattacagctttagacaaattgttccagtcccaataaatc
agtatccggcatgtggcagggggaaggcttctagctctgctgcatcctgggccccccttg
tcctaccacacaggcaaggctctgcttggggccaccctggccagccctcCACCATTTCCT
GAAGCCATT
Primer
(+)TCCTGGAGGCCTTGTAAATG
(+)AATGGCTTCAGGAAATGGTG