Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs329 ]


Position: chr10:124,851,813-124,853,071 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ACADSB - HMX3

Expression Pattern
limb (5 out of 5 embryos) 

Embryo 1


Embryo 2


Embryo 3


Fasta sequence
GGTCCCCTGAATACAACAGCctttcttctctgaaggttatctgctaagcaccaaactttg
agagctgccagccatgactgccccagcgagggcagacacaggcccaaccgcgatggaaag
ggaggccgagttctattttatctctggctgcgtcagcccctttaaatgtcctcaattccc
ctacttggaaagtccctggataacacgttatttaaatgaacctattccacatcttccatg
gttacttacttttctcaatgacgaatcttaaaacggattgtctgtaaaagatcatctgta
ctttaccaatatccaggctccccctccccaaaaaaactgtcagaggtacaccacgtgtgt
gaaactagtcgatttccttaattcatccctggagaatggataagtctatcaatctattaa
attggaaagccattaggaggcctggtttatgcgtttcaagctgttaactagaagttgatt
gattgttgttcctctgataggatatgctgatctaatctcactgtgctccagtttgcaata
aattacacaattcatttcctccatttagagagagaaaatcacacctccaggcatgcctgc
ttcagaggcaaagagcaggaagcctattttatggtgccatttagcctgcaagctttcagc
aatccttgcctccaaaaaatcgaagcataatcaaggtgtatgtttggaaaatttattgtt
ataattttccccaagtaatctcctccattttccaggcgctccaacggcataagtcatcat
ctaaaagagaaaatgaatagcagtttaaaatttatcggtctttgattctcaattatacgt
gtttatgacttcatctgtcttcagtgacttcaaccttttccattatggtggaatattatt
tgtacgggatccattaaattcacaatccagccctaatggtaggctgtagcgtttccagaa
gaaaatttttgaaaggtggtttgcagaaagcgaagctgttatgacactagaaattgcttt
attgatagcctcgcctctcgcctgaacattttgcaatttgtaacctggcccatatctata
tttcaggctgacgttgataagaacccttctgccccccacaccagattacactttgtaatg
acatggagaatgcagggtggggagggggaccgagaagggcagccaccttcttcctcctcc
ctgtccccagctgtcctcctcctcctctccattgagaagGAAGATGGTGGAAGGGGATT
Primer
(+)GGTCCCCTGAATACAACAGC
(+)AATCCCCTTCCACCATCTTC