Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs327 ]


Position: chr1:88,926,796-88,928,508 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC100505768 - LOC101927891

Timepoints:
e11.5

Publications:

Expression Pattern
hindbrain (rhombencephalon) (8 out of 10 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5

Embryo 6

Embryo 7

Embryo 8

Fasta sequence
GTGAAAGGAGCAGGAAGCAGGCAGAGGGAACCCATGCACTCTGGGAAACA
GTACACAGCCTAAATGTATTTTCTCTCACTGATGTATTTTAAATTTGTGA
CTATGAATATACCACAGTGAACAGCTTGAAGTTCTTTGGAACAAACATCT
TCTAAGGTCACTCCTGAAGGAACTGCAATAATAACATTTGGCATATGCAG
ATAGAGTGCTTTGCAGACTGGAGCATGGAGAATTATGCTCGGCATGTTCC
AGAAAAGATGATCCATGATTCAGGTGAAAAAAATGTCAGGTACATTTTTG
ACAGTGGCAGCAAACCCAAACAGTGTAACCAAACAATCAATATGGACGCC
CTCATTAAAATCCCCCAGTAGCTGCGAGTTTGATTTTCAGCAGGGTCTGG
ACAGGAATAATAGATTTGGTGGCCTGGAGGAACATTAGAGGTTTTAATAA
AAGGAACTTAAAATTACCATTGTTGGCCCTGGTTCCAAGGAAGCCCTGGT
TGGGTGTCTGTAACAACACAGGATGAACCTAATTCCTCGCCTCTCGGATT
CTTGCTATTCAGCTTAAAATGCCATTTTATGTAAGCCTGATAATTTCTCC
TCAAAAATAAATTCATAAAAATTGCTTGAAAATTCCTGATCAATGTTTTC
AGCTCACATAGATATTAAACCGAATTTCCTAAAGCCTGAAAAGTTAATTA
TGCATTCAATTAGAGTTTCTTAATAAAGATTAAAACTCTGAAGTCTATTA
CAAGCCCATATTTAATTCAACTGCCATTTTATCCACGCCATGTAAGTGTA
AGTGGTAACAATGAATATAAATTATAATACACGCCATAGAAAGAATGCTA
TTTGTCCAAGAACGTTACTATAAAGAATTAAATTTTGCTATCAGTTCCAT
GATCTAGTTAAAATTGGTATTCTTTATTTGGTCTTTCAATGTAGTCCAAT
TTCCTACTTTGAAAAACAAATTCTGGGGAATAAAGAAAAGAGATTAATTT
ATCATTAAGACTCTGCTTAATTGAAGTCAATTCCGAACAAACTTGAATTC
AATTTCTGCTCATTAAATTGAATGTGCTCTGCGTTCCTCTCTGCATTGCT
TTGAGCAAGCAGCTGAGAACAAGGGACTAACATCAAAATTATTAAATTGA
GGAGATTTTATTTGGTCTTCACATGCCAGAGCCGCTTTGATGAGGAGCTG
TTTTGGCACTGAAAGGAAAGAAGAGCAGCTGGAGGAAAAATCAAATGAAA
CTAAGCCTTGGAAAATTGAAGAAAACGCAAGCTTAATAATATTTAATAAT
TAAATTTCCACAAACAATAGCGGCAAATGAAGTAATCTGCAAAGTCTGTG
AACTCATTTGCATAATTGATGCCGGTCCCCTGTAAATGAATAATGAAGAT
AATAAAAGATGTTGCTAAAAATGGGCACAATAACAGCAAATTTCATCAAG
CCGCGCTCTCTGATTAATCTGCTCTTGCAAATCAGCACCGAGAGGGGAGC
GCGTGATTAACCGCGCCGAGGACTGCAGCAGGCGGCGGCGCTGCCCTTTC
TCTGCGTGTCTCTGGGCGCGTCCTGCCCGCTCCCCGCGCCGCCCGCGCTC
CTCTCGCCGCAGCTGCCGCTGGGGCTGCCGCGGGCGCCGCTCAGCCGGAG
CGCGCCTCCGCCCGGCCCGCCCGCGCCCCGCAGCAGCGCGCTCGCTCCTT
AACCACTTCGCCG
Primer
(+)GTGAAAGGAGCAGGAAGCAG
(+)CGGCGAAGTGGTTAAGGAG