Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs326 ]


Position: chr10:103,266,649-103,267,972 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: BTRC(intragenic)

Expression Pattern
limb (4 out of 7 embryos) 

Embryo 1


Embryo 2


Embryo 3


Fasta sequence
TTCTTCAGGCATGGACTCAGggtctctgaaaaaatttgagtgagcaaaattctcttgctt
tgctcctagatatagttcataccatgtcttaggaatccagaattattttttgaaggattt
tatgcctatatatgctgactgaacatttaataagataaccacgacattttaaaagatttt
atacaatgtacttgtttccttgcattgcccttctccctgttttttcttctcttacttccc
caagtctgtatcactggggcttttttcccattttttcccatcttgtgagcaaagttttaa
cagtacgtagaaagttaactgcctggagtcttttaaatataagtaacacgcaaccagtaa
taagctgtcggttgattttttgctgcctgcaaagaaacataaacacagcgctcatttctg
gcaggtttttactgtcagagtttctcctattatatttatcttacaatttgccagggggtg
aagttattaagttttagcagcagccatcgatcaagttcacaagttaacacgataaaggct
ctgtgccgctccgatccggggaaatgatgatcctcactcggtaattaactaaatgagaaa
gttaaatcttacttgagagctgggagagatgaaagagaggtgtttgtcagcttctcagtg
gaaattagaagcagttttctgcaattccctaagctgctgctctgtcatattttacataag
cactgggaaaatgtcttgtaattagtgctgtcatggaagatttttttttgctgaaggatg
ttggaataattcattagattatcaagaaaggctgtgtcctgaaatgattagcacagtgaa
atttaaaccattaacgataacaagtttagagcttgctgcagtgcagaggcaccccgggta
tgtctgtgcctatttcaatcatttcttataattaaacattatgtcctttttttttccctc
accactaggacccatccaaaaatccttttaaggtggcactatctacatcagtgggtttac
cagccttggaggtgtgtgtagttagtagctataataatgcaacagtaaattaaactgctg
tgaatttcttggtttagaacaaaagaacctatcaccctggaagctataaagttgcatgag
ggggccaataaagaagcttgagtttcagttttgaaacctaaaaatgttaaatgactatcc
tgtccctttaactatgtcagaaatcagaaaataatgaaaaactgctttgttctgaatttg
atgaattttatatatgacttttcctatagttagtaaataggaaAAAAAGATTGGCAAGTG
TCCA
Primer
(+)TTCTTCAGGCATGGACTCAG
(+)TGGACACTTGCCAATCTTTTT